Skip to Content
Merck

EHU055701

MISSION® esiRNA

targeting human NPY

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCGCCCGACAGCATAGTACTTGCCGCCCAGCCACGCCCGCGCGCCAGCCACCATGCTAGGTAACAAGCGACTGGGGCTGTCCGGACTGACCCTCGCCCTGTCCCTGCTCGTGTGCCTGGGTGCGCTGGCCGAGGCGTACCCCTCCAAGCCGGACAACCCGGGCGAGGACGCACCAGCGGAGGACATGGCCAGATACTACTCGGCGCTGCGACACTACATCAACCTCATCACCAGGCAGAGATATGGAAAACGATCCAGCCCAGAGACACTGATTTCAGACCTCTTGATGAGAGAAAGCACAGAAAATGTTCCCAGAACTCGGCTTGAAGACCCTGCAATGTGGTGATGGGAAATGAGACTTGCTCTCTGGCCTTTTCCTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NPY(4852)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Cheni-Chery Sudhakumari et al.
General and comparative endocrinology, 251, 54-65 (2017-03-23)
Neuropeptide-Y (NPY) has diverse physiological functions which are extensively studied in vertebrates. However, regulatory role of NPY in relation to brain ontogeny and recrudescence with reference to reproduction is less understood in fish. Present report for the first time evaluated
Claire B de La Serre et al.
American journal of physiology. Regulatory, integrative and comparative physiology, 311(5), R930-R939 (2016-11-03)
Increased neuropeptide Y (NPY) gene expression in the dorsomedial hypothalamus (DMH) has been shown to cause hyperphagia, but the pathway underlying this effect remains less clear. Hypothalamic neural systems play a key role in the control of food intake, in
Sung-Hyeok Hong et al.
Oncotarget, 6(9), 7151-7165 (2015-02-26)
Ewing sarcoma (ES) develops in bones or soft tissues of children and adolescents. The presence of bone metastases is one of the most adverse prognostic factors, yet the mechanisms governing their formation remain unclear. As a transcriptional target of EWS-FLI1