Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCACCGACTCGTACAAGGTTACTCACTATAAACAATACCCACCCAACACAAGCAAAGTTTATTCCTACTTTGAATGCCGTGAAAAGAAGACAGAAAACTCCAAAGTAAGGAAGGTGAAATACGAGGAAACAGTATTTTATGGGTTGCAGTACATTCTTAATAAGTACTTAAAAGGTAAAGTAGTGACCAAAGAGAAAATCCAGGAGGCCAAAGAAGTGTACAGAGAACATTTCCAAGATGATGTCTTTAACGAAAGAGGATGGAACTACATCCTTGAGAAATACGATGGTCATCTCCCGATTGAAGTAAAGGCTGTTCCCGAGGGCTCTGTCATCCCCAGAGGGAACGTGCTGTTCACAGTGGAAAACACAGACCCAGAGTGCTACTGGCTTACCAATTGGATTGAGACTATTCTTGTTCAGTCCTGGTATCCAATTACAGTGGCCACAA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... NAMPT(59027), Nampt(59027)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Xu He et al.
Experimental cell research, 352(1), 45-52 (2017-02-06)
Decreased bone volume and strength with aging and enhanced risk of fractures are in part due to reduced number of bone-forming mesenchymal stem cells (MSCs) and cellular dysfunction. In a previous study, we found that osteogenic differentiation of the multipotent
Min Ling et al.
Cell & bioscience, 7, 27-27 (2017-05-27)
Bone degenerative disorders like osteoporosis may be initiated by age-related shifts in anabolic and catabolic responses that control bone homeostasis. Although there are studies suggesting that metabolic changes occur with stem cell differentiation, the molecular mechanisms governing energy metabolism and
Xia Wang et al.
Scientific reports, 5, 12657-12657 (2015-08-01)
Nicotinamide phosphoribosyltransferase (NAMPT) is a promising antitumor target. Novel NAMPT inhibitors with diverse chemotypes are highly desirable for development of antitumor agents. Using high throughput screening system targeting NAMPT on a chemical library of 30000 small-molecules, we found a non-fluorescent