Skip to Content
Merck

EHU070611

MISSION® esiRNA

targeting human RBBP8

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCCCCATGTCCGATACATAGAACAAACACATACTAAATTGGAGCACTCTGTGTGTGCAAATGAAATGAGAAAAGTTTCCAAGTCTTCAACTCATCCACAACATAATCCTAATGAAAATGAAATTCTAGTAGCTGACACTTATGACCAAAGTCAATCTCCAATGGCCAAAGCACATGGAACAAGCAGCTATACCCCTGATAAGTCATCTTTTAATTTAGCTACAGTTGTTGCTGAAACACTTGGACTTGGTGTTCAAGAAGAATCTGAAACTCAAGGTCCCATGAGCCCCCTTGGTGATGAGCTCTACCACTGTCTGGAAGGAAATCACAAGAAACAGCCTTTTGAGGAATCTACAAGAAATACTGAAGATAGTTTAAGATTTTCAGATTCTACTTCAAAGACTCCTCCTCAAGAAGAATTACCTACTCGAGTGTCATCTCCTGTATTTGGAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RBBP8(5932)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Li Du et al.
Cancer research, 80(19), 4212-4223 (2020-08-21)
Elevated expression of EZH2, the enzymatic subunit of polycomb repressive complex 2 (PRC2), often occurs in cancer. EZH2 expression results in the silencing of genes that suppress tumor formation and metastasis through trimethylation of histone H3 at lysine 27 (H3K27me3)
Oriane Bombarde et al.
Molecular cancer therapeutics, 16(10), 2166-2177 (2017-06-15)
Poisons of topoisomerase II (TOP2) kill cancer cells by preventing religation of intermediate DNA breaks during the enzymatic process and thus by accumulating enzyme-drug-DNA complexes called TOP2 cleavage-complex (TOP2cc). F14512 is a highly cytotoxic polyamine-vectorized TOP2 inhibitor derived from etoposide
Isabel Soria-Bretones et al.
Nature communications, 8(1), 113-113 (2017-07-26)
DNA breaks are complex DNA lesions that can be repaired by two alternative mechanisms: non-homologous end-joining and homologous recombination. The decision between them depends on the activation of the DNA resection machinery, which blocks non-homologous end-joining and stimulates recombination. On
Ming Gao et al.
Nature communications, 11(1), 5362-5362 (2020-10-25)
Human C-terminal binding protein (CtBP)-interacting protein (CtIP) is a central regulator to initiate DNA end resection and homologous recombination (HR). Several studies have shown that post-translational modifications control the activity or expression of CtIP. However, it remains unclear whether and
Jianfeng Shen et al.
Cancer research, 79(2), 311-319 (2018-11-30)
PARP inhibitors (PARPi) have shown remarkable therapeutic efficacy against BRCA1/2-mutant cancers through a synthetic lethal interaction. PARPi exert their therapeutic effects mainly through the blockade of ssDNA damage repair, which leads to the accumulation of toxic DNA double-strand breaks specifically

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service