Skip to Content
Merck

EHU130241

MISSION® esiRNA

targeting human FOXP3

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAAATGGTGTCTGCAAGTGGCCCGGATGTGAGAAGGTCTTCGAAGAGCCAGAGGACTTCCTCAAGCACTGCCAGGCGGACCATCTTCTGGATGAGAAGGGCAGGGCACAATGTCTCCTCCAGAGAGAGATGGTACAGTCTCTGGAGCAGCAGCTGGTGCTGGAGAAGGAGAAGCTGAGTGCCATGCAGGCCCACCTGGCTGGGAAAATGGCACTGACCAAGGCTTCATCTGTGGCATCATCCGACAAGGGCTCCTGCTGCATCGTAGCTGCTGGCAGCCAAGGCCCTGTCGTCCCAGCCTGGTCTGGCCCCCGGGAGGCCCCTGACAGCCTGTTTGCTGTCCGGAGGCACCTGTGGGGTAGCCATGGAAACAGCACATTCCCAGAGTTCCTCCACAACATGGACTACTTCAAGTTCCACAACATGCGACCCCCTTTCACCTACGCCACGCTCATCCGCTGGGCCATCCTGGAGGCTCCAGAGAAGCAGCGGACACTCAAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FOXP3(50943)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Grethe Skretting et al.
Journal of cellular biochemistry, 120(8), 12924-12936 (2019-03-13)
Single nucleotide polymorphisms (SNPs) may play an important role in the risk of certain diseases. We have previously shown that the -287T/C SNP of the tissue factor pathway inhibitor (TFPI) gene promoter region exerts differential impact on TFPI mRNA expression;
Dong Fan et al.
Oncology letters, 20(6), 292-292 (2020-10-27)
Forkhead box P3 (FOXP3), an X-linked tumor suppressor gene, plays an important role in breast cancer. However, the biological functions of FOXP3 in breast cancer apoptosis remain unclear. To investigate the underlying genes and networks regulated by FOXP3 in breast
Hanwei Zhang et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 22(21), 5349-5361 (2016-11-03)
The transcriptional regulation mediating cancer cell differentiation into distinct molecular subtypes and modulating sensitivity to existing treatments is an enticing therapeutic target. Our objective was to characterize the ability of the forkhead/winged transcription factor FOXP3 to modulate the differentiation of