Skip to Content
Merck

EMU006911

MISSION® esiRNA

targeting mouse Lgals3

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATCACAATCATGGGCACAGTGAAACCCAACGCAAACAGGATTGTTCTAGATTTCAGGAGAGGGAATGATGTTGCCTTCCACTTTAACCCCCGCTTCAATGAGAACAACAGGAGAGTCATTGTGTGTAACACGAAGCAGGACAATAACTGGGGAAAGGAAGAAAGACAGTCAGCCTTCCCCTTTGAGAGTGGCAAACCATTCAAAATACAAGTCCTGGTTGAAGCTGACCACTTCAAGGTTGCGGTCAACGATGCTCACCTACTGCAGTACAACCATCGGATGAAGAACCTCCGGGAAATCAGCCAACTGGGGATCAGTGGTGACATAACCCTCACCAGCGCTAACCACGCCATGATCTAAGCCAGAAGGGGCGGCACCGAAACCGGCCCTGTGTGCCTTAGGAGTGGGAA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Rafael Yamashita Ikemori et al.
PloS one, 9(11), e111592-e111592 (2014-11-05)
Galectin-3 (gal-3) is a β-galactoside binding protein related to many tumoral aspects, e.g. angiogenesis, cell growth and motility and resistance to cell death. Evidence has shown its upregulation upon hypoxia, a common feature in solid tumors such as glioblastoma multiformes
Lili Qiao et al.
Molecular medicine reports, 13(1), 160-166 (2016-01-01)
Galectin-3 is a multifunctional β-galactoside‑binding lectin that is involved in multiple biological functions which are upregulated in malignancies, including cell growth, adhesion, proliferation, progression and metastasis, as well as apoptosis. A previous study has confirmed the roles of galecin-3 overexpression
Junxiu Liu et al.
Gynecological endocrinology : the official journal of the International Society of Gynecological Endocrinology, 30(6), 461-465 (2014-03-22)
Vascular endothelial growth factor C (VEGF-C) promotes cervical cancer metastasis, while the detailed mechanism remains obscure. Recent evidence shows that galectin-3 (Gal-3), a glycan binding protein, interacts with the VEGF receptors and reinforces their signal transduction. In this study, we