Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GAGCCTGAGGCCGACTACTACGCCAAGGAGGTCACCCGCGTGCTAATGGTGGAAACCCACAACGAAATCTATGACAAGTTCAAGCAGAGTACACACAGCATATATATGTTCTTCAACACATCAGAGCTCCGAGAAGCGGTACCTGAACCCGTGTTGCTCTCCCGGGCAGAGCTGCGTCTGCTGAGGCTCAAGTTAAAAGTGGAGCAGCACGTGGAGCTGTACCAGAAATACAGCAACAATTCCTGGCGATACCTCAGCAACCGGCTGCTGGCACCCAGCGACTCGCCAGAGTGGTTATCTTTTGATGTCACCGGAGTTGTGCGGCAGTGGTTGAGCCGTGGAGGGGAAATTGAGGGCTTTCGCCTTAGCGCCCACTGCTCCTGTGACAGCAGGGATAACACACTGCAAGTGGACATCAACGGGTTC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TGFB1(7040)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Satomi Furukawa et al.
Experimental cell research, 383(1), 111506-111506 (2019-07-22)
NOD-like receptor family, pyrin domain-containing 3 (NLRP3) is one of the key components of the inflammasome. NLRP3 also participates in the regulation of fibrosis independent of the inflammasome. In this study, we analyzed the mechanism of upregulation of NLRP3 expression
Danae E Zamboulis et al.
eLife, 9 (2020-10-17)
Mature connective tissues demonstrate highly specialised properties, remarkably adapted to meet their functional requirements. Tissue adaptation to environmental cues can occur throughout life and poor adaptation commonly results in injury. However, the temporal nature and drivers of functional adaptation remain
Hendrik Ungefroren et al.
Cancers, 12(12) (2020-12-03)
Autocrine transforming growth factor (TGF)β has been implicated in epithelial-mesenchymal transition (EMT) and invasion of several cancers including pancreatic ductal adenocarcinoma (PDAC) as well as triple-negative breast cancer (TNBC). However, the precise mechanism and the upstream inducers or downstream effectors