Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTGGAGGAGCCCAATGAGTATTATTGCTATGTCAGCAGCAGGCAGCAACCCTCACAACCTTTGGGTTGTCGCTTTGCAATGCCATAGATCCAACCACCTTATTTTTGAGCTTGGTGTTTTGTCTTTTTCAGAAACTATGAGCTGTGTCACCTGACTGGTTTTGGAGGTTCTGTCCACTGCTATGGAGCAGAGTTTTCCCATTTTCAGAAGATAATGACTCACATGGGAATTGAACTGGGACCTGCACTGAACTTAAACAGGCATGTCATTGCCTCTGTATTTAAGCCAACAGAGTTACCCAACCCAGAGACTGTTAATCATGGATGTTAGAGCTCAAACGGGCTTTTATATACACTAGGAATTCTTGACGTGGGGTCTCTGGAGCTCCAGGAAATTCGGGCACATCATA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... HAVCR2(84868)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Huapeng Lin et al.
Oncology letters, 14(5), 5899-5905 (2017-11-09)
T-cell immunoglobulin mucin (TIM)-3 is an important member of the TIM gene family, which was thought to contribute to the progression of numerous types of cancer, including hepatocellular carcinoma (HCC); however, the mechanism underlying TIM-3 functions in HCC progression has
Rong-Ti Ge et al.
Immunologic research, 64(2), 470-475 (2015-09-26)
The T helper 1 (Th1) polarization plays a critical role in the pathogenesis of a number of inflammatory disorders in the body; the remedies in the correction of polarized Th1 cells are limited. This study aims to investigate the role
Cecilia Fernandez-Ponce et al.
PloS one, 9(1), e85191-e85191 (2014-01-28)
Adaptive T cell responses are critical for controlling HCV infection. While there is clinical evidence of a relevant role for regulatory T cells in chronic HCV-infected patients, based on their increased number and function; mechanisms underlying such a phenomena are