Skip to Content
Merck

EHU060601

MISSION® esiRNA

targeting human DNMT1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGCCACAGATGCTGACAAATGAGAAGCTGTCCATCTTTGATGCCAACGAGTCTGGCTTTGAGAGTTATGAGGCGCTTCCCCAGCACAAACTGACCTGCTTCAGTGTGTACTGTAAGCACGGTCACCTGTGTCCCATCGACACCGGCCTCATCGAGAAGAATATCGAACTCTTCTTTTCTGGTTCAGCAAAACCAATCTATGATGATGACCCATCTCTTGAAGGTGGTGTTAATGGCAAAAATCTTGGCCCCATAAATGAATGGTGGATCACTGGCTTTGATGGAGGTGAAAAGGCCCTCATCGGCTTCAGCACCTCATTTGCCGAATACATTCTGATGGATCCCAGTCCCGAGTATGCGCCCATATTTGGGCTGATGCAGGAGAAGATCTACATCAGCAAGATTGTGGTGGAGTTCCTGCAGAGCAATTCCGACTCGACCTATGAGGACCTGATCAACAAGATCGAGACCACGGTTCCTCCTTCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... DNMT1(1786)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Shuhao Fu et al.
Experimental eye research, 165, 47-58 (2017-09-13)
The principle reason of high failure rate of glaucoma filtration surgery is the loss of filtration function caused by postoperative scar formation. We investigated the effects of 5-aza-2'-deoxycytidine (5-Aza-dc), a DNA methyltransferases inhibitor, on human Tenon's capsule fibroblasts (HTFs) differentiation
Fangcao Jin et al.
Stem cell research & therapy, 11(1), 444-444 (2020-10-21)
Dysfunction of the DNA methylation was associated with stem cell reprogramming. Moreover, DNA methyltransferase 1 (DNMT1) deficiency was involved in the differentiation of hair follicle stem cell (HFSc), but the molecular mechanisms remain unknown. HFSc from human scalp tissues were
Arunagiri Kuha Deva Magendhra Rao et al.
Molecular oncology, 13(6), 1342-1355 (2019-04-09)
Breast cancer is the most common malignancy among women, with the highest incidence rate worldwide. Dysregulation of long noncoding RNAs during the preliminary stages of breast carcinogenesis is poorly understood. In this study, we performed RNA sequencing to identify long