Skip to Content
Merck

EHU085291

MISSION® esiRNA

targeting human JMJD6

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTTGTTGAATGCGCAAGAGGGCTGGTCTGCGCAGGAGAAATGGACTCTGGAGCGCCTAAAAAGGAAATATCGGAACCAGAAGTTCAAGTGTGGTGAGGATAACGATGGCTACTCAGTGAAGATGAAGATGAAATACTACATCGAGTACATGGAGAGCACTCGAGATGATAGTCCCCTTTACATCTTTGACAGCAGCTATGGTGAACACCCTAAAAGAAGGAAACTTTTGGAAGACTACAAGGTGCCAAAGTTTTTCACTGATGACCTTTTCCAGTATGCTGGGGAGAAGCGCAGGCCCCCTTACAGGTGGTTTGTGATGGGGCCACCACGCTCCGGAACTGGGATTCACATCGACCCTCTGGGAACCAGTGCCTGGAATGCCTTAGTTCAGGGCCACAAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... JMJD6(23210)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Chang-Ryul Lee et al.
Carcinogenesis, 37(2), 119-128 (2015-12-10)
Cancer stem cells (CSCs) are defined as a small subpopulation of cancer cells within a tumor and responsible for initiation and maintenance of tumor growth. Thus, understanding of molecular regulators of CSCs is of paramount importance for the development of
Alec Paschalis et al.
Cancer research, 81(4), 1087-1100 (2021-04-07)
Endocrine resistance (EnR) in advanced prostate cancer is fatal. EnR can be mediated by androgen receptor (AR) splice variants, with AR splice variant 7 (AR-V7) arguably the most clinically important variant. In this study, we determined proteins key to generating
Yan Liu et al.
Oncogene, 38(7), 980-997 (2018-09-07)
Overexpression of Jumonji domain-containing 6 (JMJD6) has been reported to be associated with more aggressive breast cancer characteristics. However, the precise role of JMJD6 in breast cancer development remains unclear. Here, we demonstrate that JMJD6 has intrinsic tyrosine kinase activity