Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCTAGATCGGTTGCTTCAGGAACTTAATGCCACTCAGTTCAACATCACAGATGAAATCATGTCTCAGTTCCCATCTAGCAAGGTGGCTTCAGGAGAGCAGAAGGAGGACCAGTCTGAAGATAAGAAAAGACCCAGCCTCCCTTCCAGCCCGTCTCCTGGCCTCCCAAAGGCTTCTGCCACCTCAGCCACTCTGGAGCTGGATAGACTGATGGCCTCACTCTCTGACTTCCGCGTTCAAAACCATCTTCCAGCCTCTGGGCCAACTCAGCCACCGGTGGTGAGCTCCACAAATGAGGGCTCCCCATCCCCACCAGAGCCGACTGGCAAGGGCAGCCTAGACACCATGCTGGGGCTGCTGCAGTCCGACCTCAGCCGCCGGGGTGTTCCCACCCAGGCCAAAGGCCTCTGTGGCTCCTGCAATAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TGFB1I1(7041)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Razan Sheta et al.
Oncotarget, 8(47), 82506-82530 (2017-11-16)
The molecular basis of epithelial ovarian cancer (EOC) dissemination is still poorly understood. We have previously identified the hydrogen peroxide-inducible clone-5 (Hic-5) gene as hypomethylated in high-grade (HG) serous EOC tumors, compared to normal ovarian tissues. Hic-5 is a focal
J Paul et al.
Mucosal immunology, 11(2), 427-436 (2017-06-15)
Intestinal fibrosis is a major complication in inflammatory bowel diseases, but the regulatory mechanism that inhibits fibrosis remains unclear. Here we demonstrate that Itch-/-myofibroblasts express increased amounts of profibrotic collagen type I and α-SMA in response to IL-17. Mechanistically, we
Sonsoles Piera-Velazquez et al.
Rheumatology (Oxford, England), 59(10), 3092-3098 (2020-05-23)
SSc is a systemic fibrotic disease affecting skin, numerous internal organs and the microvasculature. The molecular pathogenesis of SSc tissue fibrosis has not been fully elucidated, although TGF-β1 plays a crucial role. The Hic-5 protein encoded by the TGF-β1-inducible HIC-5