Skip to Content
Merck

EHU097101

MISSION® esiRNA

targeting human JAK3

Sign In to View Organizational & Contract Pricing.

Select a Size



About This Item

NACRES:
NA.51
UNSPSC Code:
41105324

Product Name

MISSION® esiRNA, targeting human JAK3

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCTCTCGGACAACATCTTCTCTCGCCAGTCAGACGTCTGGAGCTTCGGGGTCGTCCTGTACGAGCTCTTCACCTACTGCGACAAAAGCTGCAGCCCCTCGGCCGAGTTCCTGCGGATGATGGGATGTGAGCGGGATGTCCCCGCCCTCTGCCGCCTCTTGGAACTGCTGGAGGAGGGCCAGAGGCTGCCGGCGCCTCCTGCCTGCCCTGCTGAGGTGAGTTGCTACAGTGGCTGGAGAGACGACATCTGCTCCATGGGCTGGTGGCCGACAGTAATCTCACGCTGGGACCTGGCCTGCAGCCCCTGCCCCAGACCTCTCACCATCACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... JAK3(3718)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Longfei Pan et al.
Experimental biology and medicine (Maywood, N.J.), 245(15), 1395-1403 (2020-07-16)
Accumulating evidence suggests that vascular remodeling due to immoderate proliferation and migration of SMCs is a common process occurring in APE. In this work, we tried to find a breakthrough in the pathological mechanism to alleviate the prognosis of APE
Jung Seok Kim et al.
International journal of nanomedicine, 13, 4817-4830 (2018-09-15)
Efficient target-specific siRNA delivery has always been a primary concern in the field of siRNA clinical application. In this study, four different types of anti-epidermal growth factor receptor (EGFR) antibody-conjugated immunonanoparticles were prepared and tested for cancer cell-targeted therapeutic siRNA
Nina A Sibbesen et al.
Oncotarget, 6(24), 20555-20569 (2015-08-06)
Aberrant activation of Janus kinase-3 (Jak3) and its key down-stream effectors, Signal Transducer and Activator of Transcription-3 (STAT3) and STAT5, is a key feature of malignant transformation in cutaneous T-cell lymphoma (CTCL). However, it remains only partially understood how Jak3/STAT

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service