Skip to Content
Merck

EHU125021

MISSION® esiRNA

targeting human GYPC

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGGAGGTGGGAGAAAATCTGGGCACATGGGGCCCCCTGGGCAGTGCAGGACAACATCAGCTCACTGGCAGGAAAGTCCTTGTTGAGGGTGAGGGGGTGCTGGGGTACCCGGGGGCTGGGGAAGCAAGGAAATAAGTCATCTGTATGCTGACTGGGGATAATGGCATCAAATGTCAGTCCTTGACATTTGGGGGGAACAGCAGGTGCCAGAGCTAAAAGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... GYPC(2995)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Jie Liu et al.
Hepatology (Baltimore, Md.), 69(4), 1535-1548 (2018-12-07)
Endocannabinoids promote energy conservation in obesity, whereas cannabinoid-1 receptor (CB1 R) blockade reverses body weight gain and insulin resistance and increases energy expenditure. Here we investigated the molecular mechanisms of the catabolic effects of CB1 R blockade in the liver.
Weiwei Cheng et al.
Neuron, 104(5), 885-898 (2019-10-08)
Hexanucleotide GGGGCC repeat expansion in C9ORF72 is the most prevalent genetic cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). One pathogenic mechanism is the aberrant accumulation of dipeptide repeat (DPR) proteins produced by the unconventional translation of expanded RNA repeats.
Charles A Berdan et al.
Cell chemical biology, 26(7), 1027-1035 (2019-05-14)
Parthenolide, a natural product from the feverfew plant and member of the large family of sesquiterpene lactones, exerts multiple biological and therapeutic activities including anti-inflammatory and anti-cancer effects. Here, we further study the parthenolide mechanism of action using activity-based protein