Skip to Content
Merck

EHU149771

MISSION® esiRNA

targeting human T

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCGTCTCCTTCAGCAAAGTCAAGCTCACCAACAAGCTCAACGGAGGGGGCCAGATCATGCTGAACTCCTTGCATAAGTATGAGCCTCGAATCCACATAGTGAGAGTTGGGGGTCCACAGCGCATGATCACCAGCCACTGCTTCCCTGAGACCCAGTTCATAGCGGTGACTGCTTATCAGAACGAGGAGATCACAGCTCTTAAAATTAAGTACAATCCATTTGCAAAAGCTTTCCTTGATGCAAAGGAAAGAAGTGATCACAAAGAGATGATGGAGGAACCCGGAGACAGCCAGCAACCTGGGTACTCCCAATGGGGGTGGCTTCTTCCTGGAACCAGCACCCTGTGTCCACCTGCAAATCCTCATCCTCAGTTTGGAGGTGCCCTCTCCCTCCCCTCCACGCACAGCTGTGACAGGTACCCAACCCTGAGGAGCCACCGGTCCTCACCCTACCCCAGCCCCTATGCTCATCGGAACAATTCTCCAACCTATTCTGACAACTCACCTGCATGTTTATCCATGCTGCAATCCCATGACAATTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... T(6862)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Yi-Hui Yu et al.
International journal of clinical and experimental pathology, 8(3), 2582-2589 (2015-06-06)
The aim of this study was to determine whether long non-coding RNA PVT1 can participate in the regulation of cardiac hypertrophy. A C57BL/6 mouse cardiac hypertrophic model was established using transverse aortic constriction (TAC). The animals subjected to sham operation
Zewen Kelvin Tuong et al.
PloS one, 11(1), e0147179-e0147179 (2016-01-27)
Nuclear hormone receptors have important roles in the regulation of metabolic and inflammatory pathways. The retinoid-related orphan receptor alpha (Rorα)-deficient staggerer (sg/sg) mice display several phenotypes indicative of aberrant lipid metabolism, including dyslipidemia, and increased susceptibility to atherosclerosis. In this
Jiaxuan Chen et al.
Journal of tissue engineering and regenerative medicine, 10(1), 40-51 (2013-06-21)
1α,25-Dihydroxyvitamin D3 [1α,25(OH)2D3] and bone morphogenetic protein-2 (BMP2) are both used to stimulate osteoblastic differentiation. 1α,25(OH)2D3 regulates osteoblasts through classical steroid hormone receptor mechanisms and through rapid responses that are mediated by two receptors, the traditional vitamin D receptor (VDR)