Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
Quality Level
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GATCCTCACCGTGGCATACTACCTGTGGACTACCTTTCTGGCTGTTGTTGTGGGCATCATCATGGTCTCCATCATCCACCCTGGTGGTGCAGCACAGAAGGAGACAACTGAACAGAGTGGAAAGCCGGTCATGAGCTCAGCTGATGCCCTCCTGGATCTTGTCCGGAACATGTTCCCAGCCAACCTGGTAGAAGCCACGTTCAAACAGTACCGCACCAAGACCACCCCAGTTATCAAGTCTCCCAGGGGAGCAGCGGAGGAGGCTCCCCGGCGGATCGTCATCTATGGGGTCCAGGAAGACAATGGCTCACGTGTGCAGAACTTTGCCCTGGATCTGACGCCCCCACCTGAGATTGTCTACAAGTCAGAGCCTGGTACCAGTGATGGCATGAACGTGCTAGGCATTGTCATCTTCTCAGCCACG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... SLC1A7(242607), Slc1a7(242607)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Michael L Schulte et al.
Nature medicine, 24(2), 194-202 (2018-01-16)
The unique metabolic demands of cancer cells underscore potentially fruitful opportunities for drug discovery in the era of precision medicine. However, therapeutic targeting of cancer metabolism has led to surprisingly few new drugs to date. The neutral amino acid glutamine
Jun Inoue et al.
Molecular therapy oncolytics, 19, 294-307 (2020-12-10)
For cutaneous squamous cell carcinoma (cSCC), topical treatment is an essential option for patients who are not candidates for, or who refuse, surgery. Epidermal growth factor receptor (EGFR) plays a key role in the development of cSCC, but EGFR tyrosine
Aoula Al-Zebeeby et al.
Haematologica, 104(5), 1016-1025 (2018-11-24)
BH3 mimetics are novel targeted drugs with remarkable specificity, potency and enormous potential to improve cancer therapy. However, acquired resistance is an emerging problem. We report the rapid development of resistance in chronic lymphocytic leukemia cells isolated from patients exposed