Skip to Content
Merck

EHU053481

MISSION® esiRNA

targeting human CDK9

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TACGAGAAGCTCGCCAAGATCGGCCAAGGCACCTTCGGGGAGGTGTTCAAGGCCAGGCACCGCAAGACCGGCCAGAAGGTGGCTCTGAAGAAGGTGCTGATGGAAAACGAGAAGGAGGGGTTCCCCATTACAGCCTTGCGGGAGATCAAGATCCTTCAGCTTCTAAAACACGAGAATGTGGTCAACTTGATTGAGATTTGTCGAACCAAAGCTTCCCCCTATAACCGCTGCAAGGGTAGTATATACCTGGTGTTCGACTTCTGCGAGCATGACCTTGCTGGGCTGTTGAGCAATGTTTTGGTCAAGTTCACGCTGTCTGAGATCAAGAGGGTGATGCAGATGCTGCTTAACGGCCTCTACTACATCCACAGAAACAAGATCCTGCATAGGGACATGAAGGCTGCTAATGTGCTTATCACTCGTGATGGGGTCCTGAAGCTGGCAGACTTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CDK9(1025)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Xiaoyang Li et al.
Journal of orthopaedic research : official publication of the Orthopaedic Research Society, 37(2), 510-521 (2018-11-30)
Synovial sarcomas hold a low genomic complexity, making it distinct from other types of soft-tissue sarcomas. Many studies focused on targeting the SS18-SSX fusion protein, which presents in over 90% of human synovial sarcomas. This protein acts as an oncogenic
Jinglu Wang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(5), 5990-6000 (2019-02-07)
Despite surgical and chemotherapeutic advances over the past few decades, the prognosis for ovarian cancer remains very poor. Although cyclin-dependent kinase (CDK) 9 has an established pathogenic role in various cancers, its function in ovarian cancer remains poorly defined. The
Muhammed H Rahaman et al.
Molecular oncology, 13(10), 2178-2193 (2019-08-10)
Colorectal cancer (CRC) remains one of the most lethal human malignancies, and pursuit of new therapeutic targets for treatment has been a major research focus. Cyclin-dependent kinase 9 (CDK9), which plays a crucial role in transcription, has emerged as a