Skip to Content
Merck

EHU134551

MISSION® esiRNA

targeting human NRP1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGCCTGAACTACCCTGAGAATGGGTGGACTCCCGGAGAGGATTCCTACCGAGAGTGGATACAGGTAGACTTGGGCCTTCTGCGCTTTGTCACGGCTGTCGGGACACAGGGCGCCATTTCAAAAGAAACCAAGAAGAAATATTATGTCAAGACTTACAAGATCGACGTTAGCTCCAACGGGGAAGACTGGATCACCATAAAAGAAGGAAACAAACCTGTTCTCTTTCAGGGAAACACCAACCCCACAGATGTTGTGGTTGCAGTATTCCCCAAACCACTGATAACTCGATTTGTCCGAATCAAGCCTGCAACTTGGGAAACTGGCATATCTATGAGATTTGAAGTATACGGTTGCAAGATAACAGATTATCCTTGCTCTGGAATGTTGGGTATGGTGTCTGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NRP1(8829)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Pezhman Salehi et al.
PLoS genetics, 13(10), e1007048-e1007048 (2017-10-24)
Neuropilin-1 (Nrp1) encodes the transmembrane cellular receptor neuropilin-1, which is associated with cardiovascular and neuronal development and was within the peak SNP interval on chromosome 8 in our prior GWAS study on age-related hearing loss (ARHL) in mice. In this
Rebecca McLennan et al.
Developmental biology, 407(1), 12-25 (2015-08-19)
Embryonic neural crest cells travel in discrete streams to precise locations throughout the head and body. We previously showed that cranial neural crest cells respond chemotactically to vascular endothelial growth factor (VEGF) and that cells within the migratory front have
Toru Nakanishi et al.
Cell death & disease, 10(2), 67-67 (2019-01-27)
Following incomplete spinal cord injury (SCI), reorganization of the corticospinal tract (CST) contributes to spontaneous motor recovery. Axotomized CST fibers form collaterals and make synapses with interneurons, followed by pruning of excess fibers. Although axonal pruning is involved in refinement