Skip to Content
Merck

EHU054171

MISSION® esiRNA

targeting human PTPN14

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCGCTAATGAGCCTTTGCTTTTCTTTGGAGTCATGTTCTATGTGCCAAATGTGTCATGGCTTCAGCAAGAGGCCACAAGATATCAGTATTACCTGCAAGTCAAAAAAGATGTGCTTGAAGGGCGATTACGATGTACATTGGACCAGGTGATTCGGCTAGCCGGCCTAGCTGTGCAAGCTGATTTTGGAGACTATAATCAGTTTGATTCTCAAGATTTCCTCAGAGAGTATGTGCTATTTCCTATGGATTTGGCCCTGGAAGAGGCTGTTCTGGAGGAGCTGACCCAGAAGGTAGCCCAAGAACACAAAGCCCACAGTGGAATCCTGCCAGCAGAAGCTGAACTGATGTACATCAATGAAGTTGAACGTTTGGATGGATTTGGACAGGAAATCTTCCCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PTPN14(5784)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Ana Lonic et al.
The Journal of cell biology, 220(2) (2021-01-08)
Receptor degradation terminates signaling by activated receptor tyrosine kinases. Degradation of EGFR occurs in lysosomes and requires the switching of RAB5 for RAB7 on late endosomes to enable their fusion with the lysosome, but what controls this critical switching is
Natalia I Díaz-Valdivia et al.
Oncogene, 39(18), 3693-3709 (2020-03-11)
Caveolin-1 (CAV1) enhanced migration, invasion, and metastasis of cancer cells is inhibited by co-expression of the glycoprotein E-cadherin. Although the two proteins form a multiprotein complex that includes β-catenin, it remained unclear how this would contribute to blocking the metastasis
Yujie Yang et al.
British journal of pharmacology, 178(7), 1524-1540 (2021-01-22)
Disturbed flow induces endothelial dysfunction and contributes to uneven distribution of atherosclerotic plaque. Emerging evidence suggests that harmine, a natural constituent of extracts of Peganum harmala, has potent beneficial activities. Here, we investigated if harmine has an atheroprotective role under