Skip to Content
Merck

EHU058911

MISSION® esiRNA

targeting human BRD8

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAACCTCCTGTGAGCGAGAGTGATGATGGCTTCAGCATACACAATGCTACACTGCAGTCACACACACTGGCAGACTCCATCCCCAGCAGCCCTGCTTCTTCACAGTTCTCTGTCTGTAGTGAGGATCAGGAAGCTATTCAGGCACAGAAAATTTGGAAGAAAGCCATCATGCTTGTATGGAGAGCTGCAGCTAATCATAGGTATGCCAATGTCTTCCTGCAGCCTGTTACAGATGACATAGCACCTGGCTACCACAGCATTGTGCAGAGGCCTATGGATTTGTCAACTATTAAGAAAAACATAGAAAATGGACTGATCCGAAGCACAGCTGAATTTCAGCGTGACATTATGCTGATGTTTCAGAATGCTGTAATGTACAATAGCTCAGACCATGATGTCTATCACATGGCAGTGGAGATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... BRD8(10902)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Anahita Lashgari et al.
Scientific reports, 8(1), 14089-14089 (2018-09-22)
Regulation of the chromatin state is crucial for biological processes such as the regulation of transcription, DNA replication, and DNA damage repair. Here we show that knockdown of the BRD8 bromodomain protein - a subunit of the p400/Tip60 complex -
Zhaoxiang Yu et al.
Archives of biochemistry and biophysics, 693, 108550-108550 (2020-08-30)
Bromodomain-containing 8 (BRD8), which belongs to the histone acetyl transferase (HAT) complex, functions as a driver in colorectal cancer. However, the role of BRD8 and its related regulatory mechanisms in hepatocellular carcinoma (HCC) remain unexplored. In this study, we found
Changping Gu et al.
Respiratory research, 16, 58-58 (2015-05-20)
Ventilator-induced lung injury (VILI) is one of the most common complications for patients with acute lung injury (ALI) or acute respiratory distress syndrome (ARDS). Although p120 is an important protein in the regulation of cell junctions, further mechanisms should be