Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GAACCTCCTGTGAGCGAGAGTGATGATGGCTTCAGCATACACAATGCTACACTGCAGTCACACACACTGGCAGACTCCATCCCCAGCAGCCCTGCTTCTTCACAGTTCTCTGTCTGTAGTGAGGATCAGGAAGCTATTCAGGCACAGAAAATTTGGAAGAAAGCCATCATGCTTGTATGGAGAGCTGCAGCTAATCATAGGTATGCCAATGTCTTCCTGCAGCCTGTTACAGATGACATAGCACCTGGCTACCACAGCATTGTGCAGAGGCCTATGGATTTGTCAACTATTAAGAAAAACATAGAAAATGGACTGATCCGAAGCACAGCTGAATTTCAGCGTGACATTATGCTGATGTTTCAGAATGCTGTAATGTACAATAGCTCAGACCATGATGTCTATCACATGGCAGTGGAGATG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... BRD8(10902)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Anahita Lashgari et al.
Scientific reports, 8(1), 14089-14089 (2018-09-22)
Regulation of the chromatin state is crucial for biological processes such as the regulation of transcription, DNA replication, and DNA damage repair. Here we show that knockdown of the BRD8 bromodomain protein - a subunit of the p400/Tip60 complex -
Zhaoxiang Yu et al.
Archives of biochemistry and biophysics, 693, 108550-108550 (2020-08-30)
Bromodomain-containing 8 (BRD8), which belongs to the histone acetyl transferase (HAT) complex, functions as a driver in colorectal cancer. However, the role of BRD8 and its related regulatory mechanisms in hepatocellular carcinoma (HCC) remain unexplored. In this study, we found
Changping Gu et al.
Respiratory research, 16, 58-58 (2015-05-20)
Ventilator-induced lung injury (VILI) is one of the most common complications for patients with acute lung injury (ALI) or acute respiratory distress syndrome (ARDS). Although p120 is an important protein in the regulation of cell junctions, further mechanisms should be