Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGCTGGCGCTCGAGTACATCGTGCCGTGCATGAACAAGCACGGCATCTGTGTGGTGGACGACTTCCTCGGCAAGGAGACCGGACAGCAGATCGGCGACGAGGTGCGCGCCCTGCACGACACCGGGAAGTTCACGGACGGGCAGCTGGTCAGCCAGAAGAGTGACTCGTCCAAGGACATCCGAGGCGATAAGATCACCTGGATCGAGGGCAAGGAGCCCGGCTGCGAAACCATTGGGCTGCTCATGAGCAGCATGGACGACCTGATACGCCACTGTAACGGGAAGCTGGGCAGCTACAAAATCAATGGCCGGACGAAAGCCATGGTTGCTTGTTATCCGGGCAATGGAACGGGTTATGTACGTCATGTTGATAATCCAAATGGAGATGGAAGATGTGTGAC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... EGLN1(54583)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Junqiang Guo et al.
Artificial cells, nanomedicine, and biotechnology, 48(1), 37-45 (2019-12-20)
Background: Prolyl hydroxylase domain proteins (PHD2) is an oxygen sensor that is able to induce hypoxia-inducible factor-α (HIF-α) degradation under normoxic condition. The present paper designed to reveal the function of PHD2 in hepatocellular carcinoma (HCC) cells proliferation, migration and
Junping Hu et al.
Scientific reports, 7(1), 15878-15878 (2017-11-22)
Proteinuria is closely associated with the progression of chronic kidney diseases (CKD) by producing renal tubulointerstitial fibrosis. Over-activation of hypoxia inducible factor (HIF)-1α has been implicated in the progression of CKD. The present study tested the hypothesis that HIF-1α mediates
Hyo Jeong Yong et al.
Oncotarget, 8(41), 69833-69846 (2017-10-21)
Hypoxia-induced interleukin-32β (IL-32β) shifts the metabolic program to the enhanced glycolytic pathway. In the present study, the underlying mechanism by which hypoxia-induced IL-32β stability is regulated was investigated in ovarian cancer cells. IL-32β expression increased under hypoxic conditions in ovarian