Skip to Content
Merck

EHU085491

MISSION® esiRNA

targeting human FGFR4

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAAAGACAACGCCTCTGACAAGGACCTGGCCGACCTGGTCTCGGAGATGGAGGTGATGAAGCTGATCGGCCGACACAAGAACATCATCAACCTGCTTGGTGTCTGCACCCAGGAAGGGCCCCTGTACGTGATCGTGGAGTGCGCCGCCAAGGGAAACCTGCGGGAGTTCCTGCGGGCCCGGCGCCCCCCAGGCCCCGACCTCAGCCCCGACGGTCCTCGGAGCAGTGAGGGGCCGCTCTCCTTCCCAGTCCTGGTCTCCTGCGCCTACCAGGTGGCCCGAGGCATGCAGTATCTGGAGTCCCGGAAGTGTATCCACCGGGACCTGGCTGCCCGCAATGTGCTGGTGACTGAGGACAATGTGATGAAGATTGCTGACTTTGGGCTGGCCCGCGGCGTCCACCACATTGACTACTATAAGAAAACCAGCAACGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FGFR4(2264)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Qiuchen Cai et al.
Life sciences, 248, 117465-117465 (2020-02-28)
Severe peripheral nerve injury leads to skeletal muscle atrophy and impaired limb function that is not sufficiently improved by existing treatments. Fibroblast growth factor 6 (FGF6) is involved in tissue regeneration and is dysregulated in denervated rat muscles. However, the
Susagna Padrissa-Altés et al.
Gut, 64(9), 1444-1453 (2014-11-25)
Fibroblast growth factors (Fgfs) are key orchestrators of development, and a role of Fgfs in tissue repair is emerging. Here we studied the consequences of inducible loss of Fgf receptor (Fgfr) 4, the major Fgf receptor (Fgfr) on hepatocytes, alone
Huan Lin et al.
Frontiers in pharmacology, 10, 1515-1515 (2020-01-11)
Endocrine fibroblast growth factor (FGF) 19 has been shown to be capable of maintaining bile acid (BA) homeostasis and thus hold promise to be a potential therapeutic agent for cholestasis liver disease. However, whether paracrine FGFs possess this BA regulatory