Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CATTCTTTCCACTGAATGCATAATGTTTAAATAGCATAAAATGAAATGCTACAAAAATTGAACTAATTTATACTTTAAAGTATTTCTGGGTTAAATGAAACAATGAAATTTTTTAGTATGTTCAACTCTCATCCAAATGGCATATGACCCTGTTTACACAGCCTAAAGCTAAAAATATTACTCTAGTTTATTCTAATCTATTGTTAAGTATTGTGCACTGTATACCAAGTTCTTAGGGCACATGAAAAATTTTAGCTGCCAAACAGGAACTAGTAAACATATGTTCCTAATAAGTGAAGGGAAAGATAATAATGATGGTCAACAATAAGCCACGTCAATGCATAAGTTGTATAGGCTAAATGTTGCTTGTAGGCTACATTAAACTCAAATGTAATAGTTTATCTTATACTCCTGGTTTGATTTGATTAGCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... FGF5(2250)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Sara Ghassemi et al.
Oncotarget, 8(50), 87750-87762 (2017-11-21)
Although FGF5 mRNA was previously found expressed in some melanoma cell lines in contrast to normal human melanocytes, neither its contribution to melanoma growth nor its expression in melanoma tissue has been investigated. Here we demonstrate that ectopic overexpression of
Zheng Zhu et al.
Oncology reports, 45(2), 501-512 (2021-01-09)
Hsa_circ_0016760 expression has been reported to be increased in non‑small cell lung cancer (NSCLC). The present study was designed to explore the role and mechanism of hsa_circ_0016760 in regulating NSCLC progression. In total, 60NSCLC patients were followed‑up for 60 months after surgery.
Yanjuan Zhou et al.
Journal of cellular biochemistry (2018-12-07)
The morbidity and mortality rates of nonsmall-cell lung cancer (NSCLC) have increased in recent years. We aimed to explore the biological role of fibroblast growth factor 5 (FGF5) in NSCLC. We first established that the expression of FGF5 was increased