Skip to Content
Merck

EHU056571

MISSION® esiRNA

targeting human CCNA2

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTATCCTCGTGGACTGGTTAGTTGAAGTAGGAGAAGAATATAAACTACAGAATGAGACCCTGCATTTGGCTGTGAACTACATTGATAGGTTCCTGTCTTCCATGTCAGTGCTGAGAGGAAAACTTCAGCTTGTGGGCACTGCTGCTATGCTGTTAGCCTCAAAGTTTGAAGAAATATACCCCCCAGAAGTAGCAGAGTTTGTGTACATTACAGATGATACCTACACCAAGAAACAAGTTCTGAGAATGGAGCATCTAGTTTTGAAAGTCCTTACTTTTGACTTAGCTGCTCCAACAGTAAATCAGTTTCTTACCCAATACTTTCTGCATCAGCAGCCTGCAAACTGCAAAGTTGAAAGTTTAGCAATGTTTTTGGGAGAATTAAGTTTGATAGATGCTGACCCATACCTCAAGTATTTGCCATCAGTTATTGCTGGAGCTGCCTTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CCNA2(890)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Fei Guo et al.
International journal of oncology, 57(1), 264-276 (2020-05-08)
Ovarian cancer is the most lethal gynecological tumor, and the 5‑year survival rate is only ~40%. The poor survival rate is due to cancer diagnosis at an advanced stage, when the tumor has metastasized. A better understanding of the molecular pathogenesis
Hemabindu Chintala et al.
Development (Cambridge, England), 142(13), 2364-2374 (2015-05-24)
Physiological angiogenesis depends on the highly coordinated actions of multiple angiogenic regulators. CCN1 is a secreted cysteine-rich and integrin-binding matricellular protein required for proper cardiovascular development. However, our understanding of the cellular origins and activities of this molecule is incomplete.
Patrick E Gygli et al.
Aging, 8(7), 1540-1570 (2016-07-19)
Various stem cell niches of the brain have differential requirements for Cyclin A2. Cyclin A2 loss results in marked cerebellar dysmorphia, whereas forebrain growth is retarded during early embryonic development yet achieves normal size at birth. To understand the differential