Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAGTGGCAAAATGCCAGTTAATGAAAACAGAACGACCAAAGCCAAACACATTTATAATCAGATGTCTCCAGTGGACTACTGTTATAGAGAGAACATTTCATGTAGATACTCCAGAGGAAAGGGAAGAATGGACAGAAGCTATCCAGGCTGTAGCAGACAGACTGCAGAGGCAAGAAGAGGAGAGAATGAATTGTAGTCCAACTTCACAAATTGATAATATAGGAGAGGAAGAGATGGATGCCTCTACAACCCATCATAAAAGAAAGACAATGAATGATTTTGACTATTTGAAACTACTAGGTAAAGGCACTTTTGGGAAAGTTATTTTGGTTCGAGAGAAGGCAAGTGGAAAATACTATGCTATGAAGATTCTGAAGAAAGAAGTCATTATTGCAAAGGATGAAGTGGCACAC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... AKT3(10000)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Guo-Qing Sui et al.
American journal of cancer research, 7(5), 1177-1187 (2017-06-01)
microRNA-338-3p (miR-338-3p) has been implicated in tumor development and progression in many types of cancers. However, the function and mechanism underlying the action of miR-383-3p in thyroid cancer remain unclear and were therefore investigated in this study by
Meng Duan et al.
Cancer management and research, 12, 2141-2154 (2020-04-11)
Long noncoding RNA (lncRNA) deregulation is frequent in human ovarian cancers (OCs), but the role of specific miRNAs involved in this disease remains elusive. LncRNA EMX2OS was previously reported to act as an oncogene in human cancers. However, their accurate
Kohji Noguchi et al.
The Journal of biological chemistry, 292(5), 1910-1924 (2016-12-29)
The suppression of mitotic Aurora kinases (AURKs) by AURK inhibitors frequently causes cytokinetic failure, leading to polyploidy or aneuploidy, indicating the critical role of AURK-mediated phosphorylation during cytokinesis. We demonstrate the deregulated expression of AKT3 in Aurora kinase inhibitor (AURKi)-resistant