Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CATTGTTGTGCCGAGAACACCGAGCACTGAACTTTGCAAAGACCTTCGTCTTTGAGAAGACGGTAGCTTCTGCAGTTAGGAGGTGCAGACACTTGCTCTCCTATGTAGTTCTCAGATGCGTAAAGCAGAACAGCCTCCCGAATGAAGCGTTGCCATTGAACTCACCAGTGAGTTAGCAGCACGTGTTCCCGACATAACATTGTACTGTAATGGAGTGAGCGTAGCAGCTCAGCTCTTTGGATCAGTCTTTGTGATTTCATAGCGAGTTTTCTGACCAGCTTTTGCGGAGATTTTGAACAGAACTGCTATTTCCTCTAATGAAGAATTCTGTTTAGCTGTGGGTGTGCCGGGTGGGGTGTGTGTGATCAAAGGACAAAGACAGTATTTTGACAAAATACGAAGTGGAGATTTACACTACATTGTACAAGGAATGAAAGTGTCACGGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... RAC1(5879)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Anika Zilch et al.
Medical microbiology and immunology, 207(3-4), 227-242 (2018-04-28)
The human cytomegalovirus (HCMV) is a common pathogen, which causes severe or even deadly diseases in immunocompromised patients. In addition, congenital HCMV infection represents a major health concern affecting especially the lung tissue of the susceptible individuals. Antivirals are a
Ha Linh Vu et al.
Pigment cell & melanoma research, 28(5), 590-598 (2015-07-16)
Whole exome sequencing of cutaneous melanoma has led to the detection of P29 mutations in RAC1 in 5-9% of samples, but the role of RAC1 P29 mutations in melanoma biology remains unclear. Using reverse phase protein array analysis to examine
Karina Graber et al.
Virus research, 276, 197835-197835 (2019-12-11)
Infections with the herpes simplex virus type 1 (HSV-1) are common and widespread. Most infections remain undetected but severe forms may develop in newborns and in immunocompromised patients. Moreover, HSV-1 might be involved in the pathogenesis of atherosclerosis, which may