Skip to Content
Merck

EHU083211

MISSION® esiRNA

targeting human TLE1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCTCGTCAGTGCTTAGCTGTGACATCTCTGTGGATGATAAGTACATAGTCACTGGCTCGGGGGACAAGAAGGCTACAGTCTATGAAGTCATCTACTGAAAACATTATGTGGTTTAACGTTTATAGTTGAATTGGGCCAAAATGTTTCGAATTTATAGAAATAGAAAAGTTGTAACTTTAAAAGAGAAAAAAAATTACAAACACCTGTTTCCAAACCTTGACAGAAAACTACTTTGAGTCTACAAAGAGGAGGCGACAAGTCCATCAGCAGAAAGTCACCTGTCTACATAGACCAAATGGAGCACCAAGGCCAAGCGGACAGAGGGGCCATGGGTTGTAGGATTGAGGAACGGAATCTGCCGACTCACATGACAGCCCATTCTTTCTTTCTGGGTGATCTGGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TLE1(7088)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Wei Chen et al.
Bioscience, biotechnology, and biochemistry, 84(6), 1176-1182 (2020-03-03)
Liver damage induced by ischemia/reperfusion (I/R) remains a primary issue in multiple hepatic surgeries. Innate immune-mediated inflammatory responses during the reperfusion stage aggravate the injury. Nevertheless, the detailed mechanism of hepatic I/R has not been fully clarified yet. Our research
Federica De Paoli et al.
FEBS letters, 590(1), 43-52 (2016-01-15)
Macrophages display heterogeneous phenotypes, including the classical M1 proinflammatory and the alternative M2 anti-inflammatory polarization states. The transducin-like enhancer of split-1 (TLE1) is a transcriptional corepressor whose functions in macrophages have not been studied yet. We report that TLE1 is
Xin Yao et al.
Oncotarget, 8(42), 72235-72249 (2017-10-27)
The Transducin-like enhancer of split 1 (TLE1) corepressor protein is overexpressed in human lung tumors and is a putative lung-specific oncogene. However, the molecular mechanism underlying its oncogenic function remains to be delineated. Here, we report an important role of