Skip to Content
Merck

EHU099501

MISSION® esiRNA

targeting human F11R

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCTTTCCTACCACTGCTGAGTGGCCTGGAACTTGTTTAAAGTGTTTATTCCCCATTTCTTTGAGGGATCAGGAAGGAATCCTGGGTATGCCATTGACTTCCCTTCTAAGTAGACAGCAAAAATGGCGGGGGTCGCAGGAATCTGCACTCAACTGCCCACCTGGCTGGCAGGGATCTTTGAATAGGTATCTTGAGCTTGGTTCTGGGCTCTTTCCTTGTGTACTGACGACCAGGGCCAGCTGTTCTAGAGCGGGAATTAGAGGCTAGAGCGGCTGAAATGGTTGTTTGGTGATGACACTGGGGTCCTTCCATCTCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... F11R(50848)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Jonas Franz et al.
PloS one, 11(1), e0146598-e0146598 (2016-01-06)
Endothelial barriers have a central role in inflammation as they allow or deny the passage of leukocytes from the vasculature into the tissue. To bind leukocytes, endothelial cells form adhesive clusters containing tetraspanins and ICAM-1, so-called endothelial adhesive platforms (EAPs).
Min Xie et al.
Cancer letters, 443, 67-79 (2018-12-07)
Multiple studies have revealed that long non-coding RNAs (lncRNAs) extensively participate in human cancer malignant progression. The long intergenic non-protein coding RNA 707 (LINC00707), 3087 bp in length, was recently reported to be an essential oncogene in promoting lung adenocarcinoma
Rodrigo G B Cruz et al.
Cancers, 13(4) (2021-03-07)
The success of breast cancer therapies targeting the human epidermal growth factor receptor-2 (HER2) is limited by the development of drug resistance by mechanisms including upregulation of HER3. Having reported that HER2 expression and resistance to HER2-targeted therapies can be