Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTGTTCAGAGGGAGCAAAGCTTGCATTCATTTCATACGCTCTTCTGTCGACGATGTTTTAAGTATGACTGCTTCCTACATCCCTTCCATGCAACACCCAACACATATAAGAGGAAGAACACAGAAACAGCTTTGGACAACAAGCCTTGTGGACCACAGTGTTACCAGCATCTGGAGGGAGCTAAGGAGTTTGCTGCTGCTCTTACTGCTGAGCGTATAAAGACACCACCTAAACGCCCAGGGGGGCGCAGAAGAGGAAGACTTCCGAATAACAGTAGCAGACCCAGCACCCCCACCATCAGTGTGCTGGAGTCAAAGGATACAGACAGTGACAGAGAAGCAGGGACTGAAACTGGGGGAGAGAACAATGATAAAGAAGAAGAAGAGAAAAAAGATGAGACGTCCAGCTCCTCTGAAGCAAATTCTCGG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... EZH2(14056), Ezh2(14056)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
B C Roy et al.
Oncogene, 34(34), 4519-4530 (2014-12-09)
The enhancer of zeste homolog-2 (EZH2) represses gene transcription through histone H3 lysine-27-trimethylation (H3K27me3). Citrobacter rodentium (CR) promotes crypt hyperplasia and tumorigenesis by aberrantly regulating Wnt/β-catenin signaling. We aimed at investigating EZH2's role in epigenetically regulating Wnt/β-catenin signaling following bacterial
Lu Lu et al.
Toxicology and applied pharmacology, 289(2), 276-285 (2015-09-30)
Lung cancer is regarded as the leading cause of cancer-related deaths, and cigarette smoking is one of the strongest risk factors for the development of lung cancer. However, the mechanisms for cigarette smoke-induced lung carcinogenesis remain unclear. The present study
Jessica Svedlund et al.
Endocrine-related cancer, 21(2), 231-239 (2013-12-03)
Primary hyperparathyroidism (pHPT) resulting from parathyroid tumors is a common endocrine disorder with incompletely understood etiology. In renal failure, secondary hyperparathyroidism (sHPT) occurs with multiple tumor development as a result of calcium and vitamin D regulatory disturbance. The aim of