Skip to Content
Merck

EHU059391

MISSION® esiRNA

targeting human CDK5RAP2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATGGCTCTGGTCCTGGATGAGAAAGACAGACTGATTGAGGAGTTGAAGCTGTCTTTGAAGAGCAAAGAAGCTTTAATTCAGTGCCTTAAAGAGGAGAAATCTCAGATGGCATGTCCTGATGAGAATGTGTCATCTGGAGAGCTCCGAGGACTTTGTGCTGCTCCAAGGGAAGAAAAGGAGAGAGAAACTGAGGCTGCACAAATGGAGCATCAGAAGGAGAGAAACAGCTTTGAAGAGAGGATCCAGGCACTTGAAGAGGACCTGAGAGAGAAGGAAAGAGAAATTGCTACAGAGAAGAAAAATAGTCTAAAGAGGGATAAAGCCATTCAGGGTTTAACCATGGCATTAAAATCAAAGGAAAAAAAGGTTGAAGAACTTAACTCTGAAATTGAAAAGCTCAGTGCTGCCTTTGCTAAAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CDK5RAP2(55755)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wangfei Chi et al.
The Journal of cell biology, 220(1) (2020-12-23)
Centrosome duplication occurs under strict spatiotemporal regulation once per cell cycle, and it begins with cartwheel assembly and daughter centriole biogenesis at the lateral sites of the mother centrioles. However, although much of this process is understood, how centrosome duplication
Shoji Hata et al.
Nature cell biology, 21(9), 1138-1151 (2019-09-05)
One of the first steps in mitotic spindle assembly is the dissolution of the centrosome linker followed by centrosome separation driven by EG5, a tetrameric plus-end-directed member of the kinesin-5 family. However, even in the absence of the centrosome linker

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service