Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGGGCTTTACGGAGGAAGTAGAGGTTATTCTTCAGTACATCTGTGAATGTGAATGCCAAAGCGAAGGCATCCCTGAAAGTCCCAAGTGTCATGAAGGAAATGGGACATTTGAGTGTGGCGCGTGCAGGTGCAATGAAGGGCGTGTTGGTAGACATTGTGAATGCAGCACAGATGAAGTTAACAGTGAAGACATGGATGCTTACTGCAGGAAAGAAAACAGTTCAGAAATCTGCAGTAACAATGGAGAGTGCGTCTGCGGACAGTGTGTTTGTAGGAAGAGGGATAATACAAATGAAATTTATTCTGGCAAATTCTGCGAGTGTGATAATTTCAACTGTGATAGATCCAATGGCTTAATTTGTGGAGGAAATGGTGTTTGCAAGTGTCGTGTGTGTGAGTGCAACCCCAACTACACTGGCAGTGCATGTGACTGTTCTTTGGATACTAGTACTTGTGAAGCCAGCAACG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ITGB1(3688)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Wenjie Yang et al.
Reproductive sciences (Thousand Oaks, Calif.), 27(1), 132-144 (2020-02-13)
This study aimed to investigate the regulatory mechanism of circular RNA CSPP1 (hsa_circ_CSPP1) in cervical cancer. Based on GEO database, differentially expressed circRNAs and mRNAs related to cervical cancer were screened out by R software. Kyoto Encyclopedia of Genes and
Kathleen Wantoch von Rekowski et al.
Biomolecules, 9(12) (2019-11-30)
Tumor cell binding to the microenvironment is regarded as the onset of therapeutic resistance, referred to as cell adhesion mediated drug resistance (CAM-DR). Here we elucidate whether CAM-DR occurs in ovarian cancer cells and contributes to still-existing cisplatin resistance. Cultivation
Rayanah Barnawi et al.
International journal of cancer, 145(3), 830-841 (2019-02-06)
Breast cancer remains the second cause of tumor-related mortality in women worldwide mainly due to chemoresistance and metastasis. The chemoresistance and metastasis are attributed to a rare subpopulation with enriched stem-like characteristics, thus called Cancer Stem Cells (CSCs). We have