Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGAGTGCAGAATTGCCTGATGCTGTGGGACCTATTGTTCAGTTACAAGAGAAACTTTATGTGCCTGTAAAAGAATACCCAGATTTTAATTTTGTTGGGAGAATCCTTGGACCTAGAGGACTTACAGCCAAACAACTTGAAGCAGAAACCGGATGTAAAATCATGGTCCGAGGCAAAGGCTCAATGAGGGATAAAAAAAAGGAGGAGCAAAATAGAGGCAAGCCCAATTGGGAGCATCTAAATGAAGATTTACATGTACTAATCACTGTGGAAGATGCTCAGAACAGAGCAGAAATCAAATTGAAGAGAGCAGTTGAAGAAGTGAAGAAATTATTGGTACCTGCAGCAGAAGGAGAAGACAGCCTGAAGAAGATGCAGCTGATGGAGCTTGCGATTCTGAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... QKI(9444)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Feng-Yang Zong et al.
PLoS genetics, 10(4), e1004289-e1004289 (2014-04-12)
Lung cancer is the leading cause of cancer-related death worldwide. Aberrant splicing has been implicated in lung tumorigenesis. However, the functional links between splicing regulation and lung cancer are not well understood. Here we identify the RNA-binding protein QKI as
Yunling Wang et al.
PloS one, 5(9) (2010-09-24)
The quaking viable (qk(v)) mouse has several developmental defects that result in rapid tremors in the hind limbs. The qkI gene expresses three major alternatively spliced mRNAs (5, 6 and 7 kb) that encode the QKI-5, QKI-6 and QKI-7 RNA
Salma H Azam et al.
Oncogene, 38(26), 5191-5210 (2019-03-29)
Angiogenesis is critical to cancer development and metastasis. However, anti-angiogenic agents have only had modest therapeutic success, partly due to an incomplete understanding of tumor endothelial cell (EC) biology. We previously reported that the microRNA (miR)-200 family inhibits metastasis through