Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CACGTCATGACTCCGAACAGGATAATTCAGACAACAACACCATCTTTGTGCAAGGCCTGGGTGAGAATGTTACAATTGAGTCTGTGGCTGATTACTTCAAGCAGATTGGTATTATTAAGACAAACAAGAAAACGGGACAGCCCATGATTAATTTGTACACAGACAGGGAAACTGGCAAGCTGAAGGGAGAGGCAACGGTCTCTTTTGATGACCCACCTTCAGCTAAAGCAGCTATTGACTGGTTTGATGGTAAAGAATTCTCCGGAAATCCTATCAAGGTCTCATTTGCTACTCGCCGGGCAGACTTTAATCGGGGTGGTGGCAATGGTCGTGGAGGCCGAGGGCGAGGAGGACCCATGGGCCGTGGAGGCTATGGAGGTGGTGGCAGTGGTGGTGGTGGCCGAGGAGGATTTCCCAGTGGAGGT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... FUS(2521)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Haibo Wang et al.
Nature communications, 9(1), 3683-3683 (2018-09-13)
Genome damage and defective repair are etiologically linked to neurodegeneration. However, the specific mechanisms involved remain enigmatic. Here, we identify defects in DNA nick ligation and oxidative damage repair in a subset of amyotrophic lateral sclerosis (ALS) patients. These defects
Lisa Gasperini et al.
Molecular biology of the cell, mbcE18020108-mbcE18020108 (2018-10-26)
RALY is a member of the heterogeneous nuclear ribonucleoprotein family whose transcriptome and interactome have been recently characterized. RALY binds poly-U rich elements within several RNAs and regulates the expression as well as the stability of specific transcripts. Here we
Michail S Kukharsky et al.
Molecular neurodegeneration, 10, 20-20 (2015-04-19)
Mutations in calcium-responsive transactivator (CREST) encoding gene have been recently linked to ALS. Similar to several proteins implicated in ALS, CREST contains a prion-like domain and was reported to be a component of paraspeckles. We demonstrate that CREST is prone