Skip to Content
Merck

EHU095401

MISSION® esiRNA

targeting human PCM1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTTGTTCAATGAATTGGCTTTCTTTAAGCTTATGCAAGATTTGGATAATAATAGTATAACTGTTAAACAGAGATGCAAAAGGAAAATAGAAGCAACTGGAGTGATACAATCTTGTGCCAAAGAGGCTAAAAGGATTCTTGAAGATCATGGCTCACCTGCTGGAGAGATTGATGATGAAGACAAAGACAAGGATGAAACTGAAACAGTTAAGCAGACTCAAACATCTGAGGTGTATGATGGTCCCAAAAATGTAAGATCTGATATTTCTGATCAAGAGGAAGATGAAGAAAGTGAAGGATGTCCA

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... PCM1(5108)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

H Kubra Gurkaslar et al.
Cell reports, 31(6), 107630-107630 (2020-05-14)
Centrosomes function in key cellular processes ranging from cell division to cellular signaling. Their dysfunction is linked to cancer and developmental disorders. Here, we identify CCDC57 as a pleiotropic regulator of centriole duplication, mitosis, and ciliogenesis. Combining proximity mapping with
Xin Li et al.
Nature communications, 8, 14866-14866 (2017-04-01)
Defective centrosome duplication is implicated in microcephaly and primordial dwarfism as well as various ciliopathies and cancers. Yet, how the centrosome biogenesis is regulated remains poorly understood. Here we report that the X-linked deubiquitinase USP9X is physically associated with centriolar

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service