Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AATCACGAGGGCTACTGCACAATACATGGCCTAAGTTCCCTCTGTTCCTTCCTCTGAATCGAATGGATGTGGGTGACCGCCCGAAGGCCTTCACAGGATGGAAGTAGAATGATTTCAGTAGATACTCATTCTTGGAAAATGCCATAGTTTTAAATTATTGTTTCCAGCTTTATCAAAGACATGTTTGAAAAATAAAAAGCATCCAAGTGAGAGCTGGTGAGACCACGTGCTGCTGGCGTAGTGTAGGCCAGACATTGACAGTCCTGACGGGAGCTCAGGGCTGCCCAGCGCCCAGCGTGCACGGGACGGCCCCACGACAGAGGGAGTCAGCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ADARB1(104)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Tingting Yue et al.
Neurochemistry international, 129, 104479-104479 (2019-05-31)
Previously we reported that gene expression of astrocytic 5-HT2B receptors was decreased in brains of depressed animals exposed to chronic mild stress (CMS) (Li et al., 2012) and of Parkinson's disease (Song et al., 2018). Depression is also one of
Zexiong Li et al.
Neurochemistry international, 134, 104689-104689 (2020-01-23)
The alcoholism and major depressive disorder are common comorbidity, with alcohol-induced depressive symptoms being eased by selective serotonin re-uptake inhibitors (SSRIs), although the mechanisms underlying pathology and therapy are poorly understood. Chronic alcohol consumption affects the activity of serotonin 2C
Tatiana Altadill et al.
Scientific reports, 7(1), 8803-8803 (2017-08-20)
Endometrial cancer (EC) remains the most common malignancy of the genital tract among women in developed countries. Although much research has been performed at genomic, transcriptomic and proteomic level, there is still a significant gap in the metabolomic studies of