Skip to Content
Merck

EHU096691

MISSION® esiRNA

targeting human ADARB1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AATCACGAGGGCTACTGCACAATACATGGCCTAAGTTCCCTCTGTTCCTTCCTCTGAATCGAATGGATGTGGGTGACCGCCCGAAGGCCTTCACAGGATGGAAGTAGAATGATTTCAGTAGATACTCATTCTTGGAAAATGCCATAGTTTTAAATTATTGTTTCCAGCTTTATCAAAGACATGTTTGAAAAATAAAAAGCATCCAAGTGAGAGCTGGTGAGACCACGTGCTGCTGGCGTAGTGTAGGCCAGACATTGACAGTCCTGACGGGAGCTCAGGGCTGCCCAGCGCCCAGCGTGCACGGGACGGCCCCACGACAGAGGGAGTCAGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ADARB1(104)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Tingting Yue et al.
Neurochemistry international, 129, 104479-104479 (2019-05-31)
Previously we reported that gene expression of astrocytic 5-HT2B receptors was decreased in brains of depressed animals exposed to chronic mild stress (CMS) (Li et al., 2012) and of Parkinson's disease (Song et al., 2018). Depression is also one of
Zexiong Li et al.
Neurochemistry international, 134, 104689-104689 (2020-01-23)
The alcoholism and major depressive disorder are common comorbidity, with alcohol-induced depressive symptoms being eased by selective serotonin re-uptake inhibitors (SSRIs), although the mechanisms underlying pathology and therapy are poorly understood. Chronic alcohol consumption affects the activity of serotonin 2C
Tatiana Altadill et al.
Scientific reports, 7(1), 8803-8803 (2017-08-20)
Endometrial cancer (EC) remains the most common malignancy of the genital tract among women in developed countries. Although much research has been performed at genomic, transcriptomic and proteomic level, there is still a significant gap in the metabolomic studies of