Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
Quality Level
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGTGTCGTATCAGCAGGAAATCTTCTAAGCCATGTTGGTCATACCATATTGGGCATGAACACAGTTCAACTATACATGAAAGTTCCAGGGAGCAGAACACCAGGTCATCAGGAAAATAACAACTTCTGTTCAGTTAACATAAATATTGGCCCAGGTGACTGTGAATGGTTTGTTGTTCCTGAAGGTTACTGGGGTGTTCTGAATGACTTCTGTGAAAAAAATAATTTGAATTTCCTAATGGGTTCTTGGTGGCCCAATCTTGAAGATCTTTATGAAGCAAATGTTCCAGTGTATAGGTTTATTCAGCGACCTGGAGATTTGGTCTGGATAAATGCAGGCACTGTTCATTGGGTTCAGGCTATTGGCTGGTGCAACAACATTGCTTGGAATGTTGGTCCACT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... KDM6A(7403), UTX(7404)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Hongya Han et al.
PloS one, 9(1), e85085-e85085 (2014-01-28)
Arachidonate 15-lipoxygenase-1 (ALOX15) oxygenates polyunsaturated fatty acids and bio-membranes, generating multiple lipid signalling mediators involved in inflammation. Several lines of evidence indicate that ALOX15 activation in the respiratory tract contributes to asthma progression. Recent experimental data reveals that histone modification
Rakel Brendsdal Forthun et al.
PloS one, 7(11), e48992-e48992 (2012-11-17)
The mechanisms of successful epigenetic reprogramming in cancer are not well characterized as they involve coordinated removal of repressive marks and deposition of activating marks by a large number of histone and DNA modification enzymes. Here, we have used a
Shayesta Seenundun et al.
The EMBO journal, 29(8), 1401-1411 (2010-03-20)
Polycomb (PcG) and Trithorax (TrxG) group proteins act antagonistically to establish tissue-specific patterns of gene expression. The PcG protein Ezh2 facilitates repression by catalysing histone H3-Lys27 trimethylation (H3K27me3). For expression, H3K27me3 marks are removed and replaced by TrxG protein catalysed