Skip to Content
Merck

EHU141181

MISSION® esiRNA

targeting human MPRIP

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human MPRIP

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTAAAATTAGGCCAGCAGTGGGGGCTGGGAGGGCATCTGTGTTAGTCCTTTCCTGGCTGTGACCCGCCACACTCACTGTCAGTATTAAGGCCCAGCAGCCTGTTGATAAGCTACCCTGTCTCACCATGTGCTGGTGTGGAAACGGGGCCCAGCCAGCACGCCTCAAGGTAGATGGAATCCCCACTGGTCAGAGAAAAAGCTATGCGGACACTCCAGCTTGGCCTGGGTCACAGCACTGACTCCTCACCCGCTAGTCTGGCTGTTAAGAGGAGAAAGTGCACTGCCTTCCAGCCCAGGAGGAGGACAGCATTTTGTATTTGTTCCACTGATGCAGCTTAGAACCACACCCCTGAGAGTCGTGGCAAACCTTTCACAACCTGGAAAATGTTGAAAGCAACCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shinichi Nakamuta et al.
The Journal of cell biology, 216(12), 4313-4330 (2017-11-02)
Throughout life, stem cells in the ventricular-subventricular zone generate neuroblasts that migrate via the rostral migratory stream (RMS) to the olfactory bulb, where they differentiate into local interneurons. Although progress has been made toward identifying extracellular factors that guide the
Min Zhang et al.
PloS one, 10(5), e0127386-e0127386 (2015-05-23)
Death signaling provided by tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) can induce death in cancer cells with little cytotoxicity to normal cells; this cell death has been thought to involve caspase-dependent apoptosis. Reactive oxygen species (ROS) are also mediators

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service