Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CACCACCACCAGCTATGAGAAGATAGTGGGCAACACCAAAGTCCTGGAGATACCCTTGGAGCCCAAAAACAACATGAGGGCAACCATCGACTGTGCGGGGATCTTGAAGCTTAGAAACGCCGACATTGAGCTGCGGAAAGGCGAGACGGACATTGGAAGAAAGAACACGCGGGTGAGACTGGTTTTCCGAGTTCACATCCCAGAGTCCAGTGGCAGAATCGTCTCTTTACAGACTGCATCTAACCCCATCGAGTGCTCCCAGCGATCTGCTCACGAGCTGCCCATGGTTGAAAGACAAGACACAGACAGCTGCCTGGTCTATGGCGGCCAGCAAATGATCCTCACGGGGCAGAACTTTACATCCGAGTCCAAAGTTGTGTTTACTGAGAAGACCACAGATGGACAGCAAATTTGGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... NFATC2(4773)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Joyce V Lee et al.
Genes & development, 32(7-8), 497-511 (2018-04-21)
The metabolite acetyl-coenzyme A (acetyl-CoA) is the required acetyl donor for lysine acetylation and thereby links metabolism, signaling, and epigenetics. Nutrient availability alters acetyl-CoA levels in cancer cells, correlating with changes in global histone acetylation and gene expression. However, the
Jasper Wouters et al.
Nature cell biology, 22(8), 986-998 (2020-08-06)
Melanoma cells can switch between a melanocytic and a mesenchymal-like state. Scattered evidence indicates that additional intermediate state(s) may exist. Here, to search for such states and decipher their underlying gene regulatory network (GRN), we studied 10 melanoma cultures using
Yanjiao Huang et al.
Experimental and therapeutic medicine, 20(2), 736-747 (2020-08-04)
Store-operated Ca2+ entry (SOCE) is the stable calcium channel influx in most cells. It consists of the cytoplasmic ion channel ORAI and endoplasmic reticulum receptor stromal interaction molecule 1 (STIM1). Abolition of SOCE function due to ORAI1 and STIM1 gene