Skip to Content
Merck

EMU015461

MISSION® esiRNA

targeting mouse Sgpp1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TACGGGCTGATTCTCATTCCCTGCTGGAGTTCACTAGTTTGCCTAAGTAGAATCTACATGGGAATGCATTCTATCCTGGATGTCATTGCTGGATTCTTGTATACCATTTTAATCTTAATTATCTTCTACCCATTGGTGGACCTGATTGACAACTTCAACCAAACTTACAAATATGCGCCGCTCATCATCATCGGGCTTCACTTAATTTTGGGCATCTTCTCTTTCACCCTTGACACCTGGAGCACATCCCGAGGAGACACGGCTGAGATTCTGGGAAGTGGTGCTGGGATTGCATGTGGCTCACACGCTGCTTATACCCTGGGCCTATCCTTAGAACCTTCTCTGCACATGTTACCCTTAGCTATCCCCCCTCTTACTGTAACTCTGTTTGGAAAAGCCATATTACGGATCGTCCTAGGAATGCTGCTT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Susumu Takeuchi et al.
International journal of oncology, 44(6), 1886-1894 (2014-04-10)
Pemetrexed (PEM) is currently recommended as one of the standard anticancer drugs for malignant pleural mesothelioma (MPM). However, the mechanism of the sensitivity of MPM to PEM remains unclear. We analyzed the antitumor effects of PEM in six MPM cell
Jun Won Park et al.
Laboratory investigation; a journal of technical methods and pathology, 95(6), 660-671 (2015-04-14)
Osteopontin (OPN) is a multifunctional protein that plays a role in many physiological and pathological processes, including inflammation and tumorigenesis. Here, we investigated the involvement of OPN in Helicobacter pylori (HP)-induced gastritis using OPN knockout (KO) mice and OPN knockdown
Yunsheng Yuan et al.
Applied biochemistry and biotechnology, 173(2), 421-432 (2014-03-26)
Secreted phosphoprotein 1 (SPP1) is a phosphorylated acidic glycoprotein. It is broadly expressed in a variety of tissues, and it is involved in a number of physiological and pathological events, including cancer metastasis, tissues remodeling, pro-inflammation regulation, and cell survival.