Skip to Content
Merck

EMU063451

MISSION® esiRNA

targeting mouse Cdk5

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TATTTCGACAGCTGCAATGGTGACCTGGACCCTGAGATTGTGAAGTCATTCCTCTTCCAGCTGCTGAAAGGCCTGGGATTCTGTCACAGCCGCAACGTGCTACATAGGGACCTGAAGCCCCAGAACCTGCTCATAAACAGGAATGGGGAGTTGAAATTGGCTGATTTTGGCCTGGCCCGAGCCTTTGGTATCCCCGTCCGCTGCTACTCTGCTGAGGTGGTCACGCTGTGGTACCGCCCACCGGATGTCCTCTTTGGGGCCAAGCTGTACTCCACGTCCATCGACATGTGGTCAGCCGGCTGCATCTTTGCAGAGCTGGCTAATGCAGGACGACCTCTCTTCCCTGGCAATGATGTGGATGACCAGCTGAAGAGGATCTTCCGACTGCTAGGGACACCGACTGAGGAA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Johanna Liebl et al.
Nature communications, 6, 7274-7274 (2015-06-02)
The lymphatic system maintains tissue fluid balance, and dysfunction of lymphatic vessels and valves causes human lymphedema syndromes. Yet, our knowledge of the molecular mechanisms underlying lymphatic vessel development is still limited. Here, we show that cyclin-dependent kinase 5 (Cdk5)
Julia Lindqvist et al.
Molecular biology of the cell, 26(11), 1971-1984 (2015-04-09)
Contrary to cell cycle-associated cyclin-dependent kinases, CDK5 is best known for its regulation of signaling processes in differentiated cells and its destructive activation in Alzheimer's disease. Recently, CDK5 has been implicated in a number of different cancers, but how it
Shu Zhang et al.
PloS one, 10(7), e0131833-e0131833 (2015-07-07)
Cyclin-dependent kinase 5 (CDK5) is a cytoplasmic serine/ threonine kinase. Knockdown of CDK5 enhances paclitaxel sensitivity in human ovarian cancer cells. This study explores the mechanisms by which CDK5 regulates paclitaxel sensitivity in human ovarian cancers. Multiple ovarian cancer cell