Skip to Content
Merck

EMU078351

MISSION® esiRNA

targeting mouse Spag9

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGCACTGCATCAGAGACACACTGAGATGATCCATAATTATATGGAACACTTAGAAAGAACCAAACTTCATCAGCTCTCAGGGAGTGATCAACTAGAGGCTACAGCTCATAGTAGAATTAGAAAAGAACGTCCTATATCATTAGGGATTTTCCCTCTACCTGCTGGAGATGGATTGCTTACACCTGACACTCAGAAAGGAGGCGAGACCCCAGGATCAGAGCAATGGAAATTTCAAGAATTAAGTCAACCATGTTCTCATACCAGCCTGAAGGATGAACTTTCTGATATTAGTCAAGGTGGATCTAAAGCTACCACTCCAGCTTCAACAGCAAATTCAGATGTATCAGCAATTCCTCCTGATACTCCGTCAAAGGAAGATAATGAAGGATTTGTAAAAGGCACAGATACATCAAATAAGTCAGAGATAAGCAAACACATAGAAGTCCAGGTTGCCCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Feifei Chen et al.
Oncology reports, 32(6), 2533-2540 (2014-10-14)
Sperm-associated antigen 9 (SPAG9) is a recently characterized oncoprotein involved in the progression of several human malignancies. To elucidate the role of SPAG9 in the development of human prostate cancer (PCa), tissue microarray (TMA) and immunohistochemistry were used to detect
Hui Li et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(7), 6949-6954 (2014-04-18)
Sperm-associated antigen 9 (SPAG9) was recently reported to be overexpressed in several cancers and associated with the malignant behavior of cancer cells. However, the expression pattern of SPAG9 and its clinical significance in human prostate cancer have not been reported.
Zhi-Feng Miao et al.
Virchows Archiv : an international journal of pathology, 467(5), 525-533 (2015-08-22)
Sperm associated antigen 9 (SPAG9) protein has been found to play an important role in cancer progression but the involved mechanisms are still obscure. Its clinical significance in human gastric cancers remains unexplored. In the present study, SPAG9 expression was