Skip to Content
Merck

EHU100971

MISSION® esiRNA

targeting human PRC1

Sign In to View Organizational & Contract Pricing.

Select a Size



About This Item

NACRES:
NA.51
UNSPSC Code:
41105324

Product Name

MISSION® esiRNA, targeting human PRC1

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGACCAGCGGTTACAAAGAACTGAGGTGGTAAAGAAGCATATCAAGGAACTCCTGGATATGATGATTGCTGAAGAGGAAAGCCTGAAGGAAAGACTCATCAAAAGCATATCCGTCTGTCAGAAAGAGCTGAACACTCTGTGCAGCGAGTTACATGTTGAGCCATTTCAGGAAGAAGGAGAGACGACCATCTTGCAACTAGAAAAAGATTTGCGCACCCAAGTGGAATTGATGCGAAAACAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tianxiang Xu et al.
Cancer cell international, 20(1), 528-528 (2020-12-10)
Protein regulator of cytokinesis 1 (PRC1) has been reported to play important role in the pathogenesis of various cancers. However, its role in colon cancer has not been studied. Here, we aimed to investigate the biological functions and potential mechanism
Bin Zhang et al.
Journal of cellular and molecular medicine, 21(7), 1329-1341 (2017-02-13)
Gastric carcinoma is one of the most common malignancies worldwide and the second most frequent cause of cancer-related death in China. Protein regulator of cytokinesis 1 (PRC1) is involved in cytokinesis and plays key roles in microtubule organization in eukaryotes.
Melissa C Pamula et al.
The Journal of cell biology, 218(8), 2529-2544 (2019-06-30)
In the spindle midzone, microtubules from opposite half-spindles form bundles between segregating chromosomes. Microtubule bundles can either push or restrict chromosome movement during anaphase in different cellular contexts, but how these activities are achieved remains poorly understood. Here, we use

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service