Select a Size
About This Item
description
Powered by Eupheria Biotech
Quality Segment
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGGATCAGATGGGAAAGATGAGACCTCAGCCGTATGGTGGGACTAACCCATACTCGCAACAACAGGGACCTCCTTCAGGACCGCAACAAGGACATGGGTACCCAGGGCAGCCATATGGGTCCCAGACTCCACAGCGGTACCCCATGACCATGCAGGGCCGGGCTCAGAGTGCCATGGGCAGCCTCTCTTATGCACAGCAGATTCCACCTTATGGCCAGCAAGGCCCCAGTGCGTATGGCCAGCAGGGCCAGACTCCATACTATAACCAGCAAAGTCCTCATCCCCAGCAGCAGCCACCTTACGCCCAGCAACCACCATCCCAGACCCCTCATGCCCAG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... ARID1A(93760), Arid1a(93760)
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Regulatory Listings
Regulatory Listings are mainly provided for chemical products. Only limited information can be provided here for non-chemical products. No entry means none of the components are listed. It is the user’s obligation to ensure the safe and legal use of the product.
EMU177361-20UG: + EMU177361-50UG:
jan
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.