Saltar al contenido
Merck

EHU029361

MISSION® esiRNA

targeting human SLC25A28

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Cambiar Vistas

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGGAGTCCTTGGCTTTGAACTCACACATTACAGGACATATCACAGGCATGGCTAGTGCCTTCAGGACGGTATATCAAGTAGGTGGGGTGACCGCCTATTTCCGAGGGGTGCAGGCCAGAGTAATTTACCAGATCCCCTCCACAGCCATCGCATGGTCTGTGTATGAGTTCTTCAAATACCTAATCACTAAAAGGCAAGAAGAGTGGAGGGCTGGCAAGTGAAGTAGCACTGAACGAAGCCAGGGGTTCAGATGACACTGCTGCATCCTGGTCACATTCTCTGTCTCCTGGAATGCTCCCACCTCAAGTGGAGTTAGAAGGAAGGTAGAGGGGCTCTCCCCCAGGATTTTGGTGTTTTGACTAACACCAGTTCCTGCCAACCTCTGTTGCCACCACCTTTCCTTCCAGGCCCTAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SLC25A28(81894)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos



Changfeng Li et al.
Developmental cell, 46(4), 441-455 (2018-08-14)
Pancreatic cancer is an aggressive malignancy with changes in the tumor microenvironment. Here, we demonstrate that PINK1 and PARK2 suppressed pancreatic tumorigenesis through control of mitochondrial iron-dependent immunometabolism. Using mouse models of spontaneous pancreatic cancer, we show that depletion of Pink1 and Park2
Chunlei Wang et al.
European journal of medical research, 19, 49-49 (2014-09-27)
Among glioma treatment strategies, arsenic trioxide (As2O3) has shown efficacy as a therapeutic agent against human gliomas. However, the exact antitumor mechanism of action of As2O3 is still unclear. Mitochondria are considered to be the major source of intracellular reactive
Zili Zhang et al.
Redox biology, 36, 101619-101619 (2020-08-31)
Ferroptosis is a recently discovered form of programmed cell death, but its regulatory mechanisms are not fully understood. In the current study, we reported that the BRD7-P53-SLC25A28 axis played a crucial role in regulating ferroptosis in hepatic stellate cells (HSCs).