Iniciar sesión para ver los precios por organización y contrato.
Seleccione un Tamaño
Cambiar Vistas
Acerca de este artículo
NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarledescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTGGCATACTGGGAGGAGAAGACGAGAGTGGGGAGGCTCTACTGTGTCCAGGAGCCCTCTCTGGATATCTTCTATGATCTACCTCAGGGGAATGGCTTTTGCCTCGGACAGCTCAATTCGGACAACAAGAGTCAGCTGGTGCAGAAGGTGCGGAGCAAAATCGGCTGCGGCATCCAGCTGACGCGGGAGGTGGATGGTGTGTGGGTGTACAACCGCAGCAGTTACCCCATCTTCATCAAGTCCGCCACACTGGACAACCCGGACTCCAGGACGCTGTTGGTACACAAGGTGTTCCCCGGTTTCTCCATCAAGGCTTTCGACTACGAGAAGGCGTACAGCCTGCAGCGGCCCAATGACCACGAGTTTATGCAGCAGCCGTGGACGGGCTTTACCGTGCAGATCAGCTTTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SMAD7(4092)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Clase de almacenamiento
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Elija entre una de las versiones más recientes:
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
R B Luwor et al.
Oncogene, 32(19), 2433-2441 (2012-07-04)
Transforming Growth Factor-β (TGF-β) and Epidermal Growth Factor (EGF) signaling pathways are both independently implicated as key regulators in tumor formation and progression. Here, we report that the tumor-associated overexpression of epidermal growth factor receptor (EGFR) desensitizes TGF-β signaling and
Lili Du et al.
Cardiology, 138(1), 55-62 (2017-06-02)
Eplerenone (EPL), an antagonist of the mineralocorticoid receptor, is beneficial for atrial fibrillation and atrial fibrosis. However, the underlying mechanism remains less well known. We aimed to investigate the effect of EPL on atrial fibrosis using a mouse with selective
Tianming Liu et al.
Oncology letters, 14(4), 3941-3946 (2017-09-26)
MicroRNA (miR)-590 has been established to be a promoter of cell proliferation, migration and invasion, and an inhibitor of apoptosis in numerous cancer cell lines. However, its effects on non-cancer cells remain to be elucidated. miR-590 was transfected into human