Iniciar sesión para ver los precios por organización y contrato.
Seleccione un Tamaño
Cambiar Vistas
Acerca de este artículo
NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarledescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCTGAAGCAGAGGAGGAAGAGGAAGAGTGAGGGATGGAGAAAGGGCAGAGGAAGAGACATGAGAAAGGGAGAGGAAGAGAAGCCCAGCTCTGGGAACTGAATCAGGAAACTCAAATCGAATAGGGAAGTAAAAAAACAAAACAAAAAACAAAAAAAACAAAAAAAAAACCCTATTTAAATGAAAGGAGTTTAAAAACATTTTTTAAGGAGGGAGAAAGGAGAAATTTTGGTTTTTCAACACTGAAAAAATACTACCTATAGGAAAGTCTGTCAGGTTTGGTTTTTTTGTACAATATGAAAAGGATATTATCTACCTGTTCTGTAGCTTTCTGGAATTTACCTCCCCTTTTCTATGTTGCTATTGTAAGGTCTTTGTAAAATCTTGCAGTTTTGTAAGCCCT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... HOXB7(3217)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Clase de almacenamiento
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Elija entre una de las versiones más recientes:
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Wei-Min Wang et al.
Oncotarget, 8(29), 47121-47135 (2017-04-30)
The homeobox-containing gene HOXB7 plays an important role in the pathogenesis and progression of many cancers, yet its role in hepatocellular carcinoma (HCC) remains unclear. This study comprehensively analyzed the expression and clinical significance of HOXB7 in HCC and explored
Longfei Dai et al.
Laboratory investigation; a journal of technical methods and pathology, 99(6), 736-748 (2019-01-22)
Homeobox B7 (HOXB7) protein is reported to be aberrantly expressed in a variety of cancers and to play an important role in multiple cellular processes. However, the specific mechanism by which HOXB7 promotes the malignant progression of intrahepatic cholangiocarcinoma (ICC)