EHU054851
MISSION® esiRNA
targeting human HDAC6
Iniciar sesión para ver los precios por organización y contrato.
Seleccione un Tamaño
Cambiar Vistas
Acerca de este artículo
NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarledescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCATGGAAATTCTGGACACCCGCTGGTCCTCAGCTACATCGACCTGTCAGCCTGGTGTTACTACTGTCAGGCCTATGTCCACCACCAGGCTCTCCTAGATGTGAAGAACATCGCCCACCAGAACAAGTTTGGGGAGGATATGCCCCACCCACACTAAGCCCCAGAATACGGTCCCTCTTCACCTTCTGAGGCCCACGATAGACCAGCTGTAGCTCATTCCAGCCTGTACCTTGGATGAGGGGTAGCCTCCCACTGCATCCCATCCTGAATATCCTTTGCAACTCCCCAAGAGTGCTTATTTAAGTGTTAATACTTTTAAGAGAACTGCGACGATTAATTGTGGATCTCCCCCTGCCCATTGCCTGCTTGAGGGGCACCACTACTCCAGCCCAGAAGGAAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... HDAC6(10013)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Clase de almacenamiento
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Elija entre una de las versiones más recientes:
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Mo Cheng et al.
European journal of pharmacology, 840, 1-8 (2018-10-03)
Emerging evidence shows that cytokines such as interleukins (ILs) are involved in the progression and chemoresistance of multiple tumors, including osteosarcoma (OS). Our present study established the doxorubicin (Dox) resistant human OS MG-63 and HOS cells and named them MG-63/Dox
Lei Yang et al.
Journal of molecular and cellular cardiology, 127, 143-153 (2018-12-26)
Extracellular pH strongly affects cellular metabolism and function. An acidic environment induced under pathological conditions leads to cardiomyocyte injury and dysfunction, but the underlying mechanisms are still poorly understood. Autophagy has been reported as a cytoprotective mechanism that maintains cellular
Liuqing Xu et al.
Oncotarget, 8(51), 88730-88750 (2017-11-29)
The role of histone deacetylase 6 (HDAC6) in peritoneal fibrosis remains unknown. In this study, we examined the effect of HDAC6 inhibition on the epithelial-mesenchymal transition (EMT) of peritoneal mesothelial cells and development of peritoneal fibrosis. Treatment with tubastatin A