Saltar al contenido
Merck

EHU056991

MISSION® esiRNA

targeting human CLOCK

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Cambiar Vistas

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGCACACATAGGCCATCTTATGAAGATAGAGTTTGTTTTGTAGCTACTGTCAGGTTAGCTACACCTCAGTTCATCAAGGAAATGTGCACTGTTGAAGAACCCAATGAAGAGTTTACATCTAGACATAGTTTAGAATGGAAGTTTCTGTTTCTAGATCACAGGGCACCACCCATAATAGGGTATTTGCCATTTGAAGTTCTGGGAACATCAGGCTATGATTACTATCATGTGGATGACCTAGAAAATTTGGCAAAATGTCATGAGCACTTAATGCAATATGGGAAAGGCAAATCATGTTATTATAGGTTCCTGACTAAGGGGCAACAGTGGATTTGGCTTCAGACTCATTATTATATCACTTACCATCAGTGGAATTCAAGGCCAGAGTTTATTGTTTGTACTCACACTGTAGTAAGTTATGCAGAAGTTAGGGCTGAAAGACGACG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CLOCK(9575)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos



Pan Jiang et al.
International journal of molecular medicine, 46(6), 2216-2224 (2020-10-31)
Circadian rhythm plays an important role in diverse physiological processes. Abnormal expression of circadian rhythm genes is associated with increased risk of disease, including different types of cancer. The cancer stem cell (CSC) hypothesis suggests that there is a small
Soon Young Shin et al.
Scientific reports, 7(1), 11175-11175 (2017-09-13)
The juice of Ageratum houstonianum is used in folk medicine as an external wound healing aid for skin injuries. However, the active component of A. houstonianum and its mode of action in skin wound healing has not been investigated. This
Qixia Jiang et al.
Acta biochimica et biophysica Sinica, 50(9), 869-879 (2018-08-21)
To explore the association between clock circadian regulator circadian locomotor output cycles kaput gene (CLOCK) and the forming of atherosclerotic plaques and its underlying mechanisms, mouse aortic endothelial cells (MAECs) and atherosclerosis (AS) mouse model were recruited for our study.