Saltar al contenido
Merck

EHU072741

MISSION® esiRNA

targeting human RORA

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Cambiar Vistas

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle


Quality Level

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGTGCCTTTGACTCTCAGAACAACACCGTGTACTTTGATGGGAAGTATGCCAGCCCCGACGTCTTCAAATCCTTAGGTTGTGAAGACTTTATTAGCTTTGTGTTTGAATTTGGAAAGAGTTTATGTTCTATGCACCTGACTGAAGATGAAATTGCATTATTTTCTGCATTTGTACTGATGTCAGCAGATCGCTCATGGCTGCAAGAAAAGGTAAAAATTGAAAAACTGCAACAGAAAATTCAGCTAGCTCTTCAACACGTCCTACAGAAGAATCACCGAGAAGATGGAATACTAACAAAGTTAATATGCAAGGTGTCTACCTTAAGAGCCTTATGTGGACGACATACAGAAAAGCTAATGGCATTTAAAGCAATATACCCAGACATTGTGCGACTTCATTTTCCTCCATTATACAAGGAGTTGTTCACTTCAGAATTTGAGCCAGCAATGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RORA(6095)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos



Hao Hu et al.
The Biochemical journal, 477(18), 3583-3598 (2020-07-21)
Estrogen sulfotransferase (SULT1E1) metabolically inactivates estrogen and SULT1E1 expression is tightly regulated by multiple nuclear receptors. Human fetal, but not adult, livers express appreciable amounts of SULT1E1 protein, which is mimicked in human hepatoma-derived HepG2 cells cultured in high glucose
Hongyu Li et al.
Journal of cellular physiology, 233(1), 641-650 (2017-03-24)
Low O2 pressures present in the microenvironment of epidermis control keratinocyte differentiation and epidermal barrier function through hypoxia inducible factors (HIFs) dependent gene expression. This study focuses on investigating relations of the retinoic acid receptor-related orphan receptor alpha (RORα) to
Juho Heliste et al.
BMC cardiovascular disorders, 18(1), 196-196 (2018-10-22)
Receptor tyrosine kinases (RTK) are potential targets for the treatment of ischemic heart disease. The human RTK family consists of 55 members, most of which have not yet been characterized for expression or activity in the ischemic heart. RTK gene