Saltar al contenido
Merck

EHU081461

MISSION® esiRNA

targeting human AXL

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Cambiar Vistas

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGATCAATTATAGTTTCTGAGGCTTTATGATAATAGATTCTCTTGTATAAGATCCTAGATCCTAAGGGTCGAAAGCTCTAGAATCTGCAATTCAAAAGTTCCAAGAGTCTAAAGATGGAGTTTCTAAGGTCCGGTGTTCTAAGATGTGATATTCTAAGACTTACTCTAAGATCTTAGATTCTCTGTGTCTAAGATTCTAGATCAGATGCTCCAAGATTCTAGATGATTAAATAAGATTCTAACGGTCTGTTCTGTTTCAAGGCACTCTAGATTCCATTGGTCCAAGATTCCGGATCCTAAGCATCTAAGTTATAAGACTCTCACACTCAGTTGTGACTAACTAGACACCAAAGTTCTAATAATTTCTAATGTTGGACACCTTTAGGTTCTTTGCTGCATTCTGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... AXL(558)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos



Jian-Zhong Lin et al.
Oncotarget, 8(25), 41064-41077 (2017-04-30)
Resistance to docetaxel is a major clinical problem in advanced prostate cancer. The overexpression of AXL receptor tyrosine kinase (AXL) has been correlated with chemotherapeutic drug resistance. However, the role of AXL expression in docetaxel resistance in prostate cancer is
Wenwen Du et al.
Oncology reports, 44(1), 185-195 (2020-04-23)
Gefitinib is currently the preferred treatment for non‑small cell lung cancer (NSCLC) patients with epidermal growth factor receptor (EGFR)‑activating mutation. However, some patients gradually develop acquired resistance after receiving treatment. In addition to secondary T790M mutation, the remaining mechanisms contributing
Nellie K McDaniel et al.
Molecular cancer therapeutics, 17(11), 2297-2308 (2018-08-11)
The TAM (TYRO3, AXL, MERTK) family receptor tyrosine kinases (RTK) play an important role in promoting growth, survival, and metastatic spread of several tumor types. AXL and MERTK are overexpressed in head and neck squamous cell carcinoma (HNSCC), triple-negative breast