Saltar al contenido
Merck

EHU083501

MISSION® esiRNA

targeting human AKT1, RP11-982M15.2

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Cambiar Vistas

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAATCCGATTCACGTAGGGAAATGTTAAGGACTTCTGCAGCTATGCGCAATGTGGCATTGGGGGGCCGGGCAGGTCCTGCCCATGTGTCCCCTCACTCTGTCAGCCAGCCGCCCTGGGCTGTCTGTCACCAGCTATCTGTCATCTCTCTGGGGCCCTGGGCCTCAGTTCAACCTGGTGGCACCAGATGCAACCTCACTATGGTATGCTGGCCAGCACCCTCTCCTGGGGGTGGCAGGCACACAGCAGCCCCCCAGCACTAAGGCCGTGTCTCTGAGGACGTCATCGGAGGCTGGGCCCCTGGGATGGGACCAGGGATGGGGGATGGGCCAGGGTTTACCCAGTGGGACAGAGGAGCAAGGTTTAAATTTGTTATTGTGTATTATGTTGTTCAAATGCATTTTGGGGGTTTTTAATCTTTGTGACAGGAAAGCCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... AKT1(207)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos



Farrukh Aqil et al.
Cancer letters, 449, 186-195 (2019-02-17)
Gene-silencing with targeted siRNAs has great potential as a therapeutic approach for various diseases including cancer. However, intracellular delivery of siRNA is challenging. We used bovine milk exosomes as a novel system for siRNA delivery. First, we demonstrated that exosomes
Guoxing Xu et al.
Scientific reports, 7, 42411-42411 (2017-02-17)
Recent studies have shown that some members of the tripartite motif-containing protein (TRIM) family serve as important regulators of tumorigenesis. However, the biological role of TRIM14 in osteosarcoma remains to be established. In this study, we showed that TRIM14 is
Gang Shen et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 50(2), 798-809 (2018-10-12)
Bromodomain-containing protein 4 (BRD4) overexpression participates in prostate cancer progression by enhancing the transcriptional activity and expression of several key oncogenes. AZD5153 is a novel BRD4 inhibitor. Prostate cancer cells were treated with AZD5153. Cell survival was tested by MTT