Saltar al contenido
Merck

EHU092581

MISSION® esiRNA

targeting human ATG7

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

Nombre del producto

MISSION® esiRNA, targeting human ATG7

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTGTCAAACAGAAGGAGTCACAGCTCTTCCTTACTTCTTAATCAAGTATGATGAGAACATGGTGCTGGTTTCCTTGCTTAAACACTACAGTGATTTCTTCCAAGGTCAAAGGACGAAGATAACAATTGGTGTATATGATCCCTGTAACTTAGCCCAGTACCCTGGATGGCCTTTGAGGAATTTTTTGGTCCTAGCAGCCCACAGATGGAGTAGCAGTTTCCAGTCTGTTGAAGTTGTTTGCTTCCGTGACCGTACCATGCAGGGGGCGAGAGACGTTGCCCACAGCATCATCTTCGAAGTGAAGCTTCCAGAAATGGCATTTAGCCCAGATTGTCCTAAAGCAGTTGGATGGGAAAAGAACCAGAAAGGAGGCATGGGACCAAGGATGGTGAACCTCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chao Zhang et al.
Journal of experimental & clinical cancer research : CR, 36(1), 162-162 (2017-11-18)
Glioblastoma multiforme (GBM) is characterized by lethal aggressiveness and patients with GBM are in urgent need for new therapeutic avenues to improve quality of life. Current studies on tumor invasion focused on roles of cytokines in tumor microenvironment and numerous
Zhuhui Qiao et al.
Cell death discovery, 6, 31-31 (2020-05-08)
Autophagy is a process involving the self-digestion of components that participates in anti-oxidative stress responses and protects cells against oxidative damage. However, the role of autophagy in the anti-oxidative stress responses of melanocytes remains unclear. To investigate the role of
Ben C King et al.
Cell metabolism, 29(1), 202-210 (2018-10-09)
We show here that human pancreatic islets highly express C3, which is both secreted and present in the cytosol. Within isolated human islets, C3 expression correlates with type 2 diabetes (T2D) donor status, HbA1c, and inflammation. Islet C3 expression is
Yongsong Cai et al.
Scientific reports, 6, 37845-37845 (2016-11-30)
Oxymatrine (OMT) is a type of alkaloid extracted from a traditional Chinese medicinal herb, Sophora flavescens. Although the antitumor activities of OMT have been observed in various cancers, there are no reports regarding the effects of OMT on human synovial
Tetsuya Saito et al.
Nature communications, 10(1), 1567-1567 (2019-04-07)
Selective autophagy ensures the removal of specific soluble proteins, protein aggregates, damaged mitochondria, and invasive bacteria from cells. Defective autophagy has been directly linked to metabolic disorders. However how selective autophagy regulates metabolism remains largely uncharacterized. Here we show that

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico